{ "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///A/3", "nt2": "///A/15", "bp": "A+T", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -85.045, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 34.309, "chi2": -110.349, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 43.391, "C1C1_dist": 10.905, "N1N9_dist": 8.778, "C6C8_dist": 9.632, "CNNC_torsion": 153.110, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.99],N1-N3(imino)[2.92]", "interBase_angle": 40.046, "planarity": 0.473, "simple_Shear": 1.264, "simple_Stretch": 0.312, "simple_Buckle": -40.046, "simple_Propeller": 0.049, "bp_simpleParams": [ 1.264, 0.312, -0.709, -40.046, 0.049, 170.209 ], "bp_params": [ -0.152, 1.293, -0.709, -5.048, -39.726, 170.779 ], "frame": { "rmsd": null, "origin": [ -3.608, -0.549, -4.223 ], "x_axis": [ -0.062, -0.994, -0.095 ], "y_axis": [ 0.798, 0.008, -0.603 ], "z_axis": [ 0.600, -0.113, 0.792 ], "quaternion": [ 0.659, -0.186, 0.264, -0.679 ] } }, { "index": 2, "nt1": "///A/4", "nt2": "///A/12", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 70.083, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 26.708, "chi2": -116.253, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 69.519, "C1C1_dist": 11.682, "N1N9_dist": 9.865, "C6C8_dist": 9.644, "CNNC_torsion": -7.961, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.96],O6(carbonyl)-N1(imino)[2.80]", "interBase_angle": 8.825, "planarity": 0.136, "simple_Shear": -2.131, "simple_Stretch": 3.052, "simple_Buckle": 7.542, "simple_Propeller": 4.582, "bp_simpleParams": [ -2.131, 3.052, 0.331, 7.542, 4.582, 88.666 ], "bp_params": [ -2.268, -2.952, 0.331, -6.639, 5.814, 88.644 ], "frame": { "rmsd": null, "origin": [ -4.164, 0.694, -1.001 ], "x_axis": [ 0.609, -0.700, -0.374 ], "y_axis": [ -0.608, -0.714, 0.347 ], "z_axis": [ -0.510, 0.016, -0.860 ], "quaternion": [ 0.093, 0.892, -0.366, -0.248 ] } }, { "index": 3, "nt1": "///A/4", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 70.083, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 64.282, "chi2": 74.760, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 27.109, "C1C1_dist": 11.829, "N1N9_dist": 9.890, "C6C8_dist": 9.627, "CNNC_torsion": -11.030, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.80],N2(amino)-N7[2.98]", "interBase_angle": 4.580, "planarity": 0.078, "simple_Shear": -2.218, "simple_Stretch": 2.971, "simple_Buckle": 4.528, "simple_Propeller": -0.686, "bp_simpleParams": [ -2.218, 2.971, -0.162, 4.528, -0.686, -89.981 ], "bp_params": [ 2.136, 3.031, -0.162, 0.754, -4.517, -90.024 ], "frame": { "rmsd": null, "origin": [ -2.532, 2.258, -2.271 ], "x_axis": [ -0.550, -0.718, 0.426 ], "y_axis": [ -0.638, 0.691, 0.340 ], "z_axis": [ -0.539, -0.085, -0.838 ], "quaternion": [ -0.275, -0.387, 0.877, 0.073 ] } }, { "index": 4, "nt1": "///A/5", "nt2": "///A/11", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -121.790, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.822, "chi2": 60.326, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 24.040, "C1C1_dist": 11.997, "N1N9_dist": 10.034, "C6C8_dist": 9.783, "CNNC_torsion": -2.922, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.85],N2(amino)-N7[3.12]", "interBase_angle": 1.880, "planarity": 0.041, "simple_Shear": -2.225, "simple_Stretch": 3.008, "simple_Buckle": -1.578, "simple_Propeller": -1.022, "bp_simpleParams": [ -2.225, 3.008, -0.154, -1.578, -1.022, -91.693 ], "bp_params": [ 2.180, 3.041, -0.154, -1.457, 1.188, -91.691 ], "frame": { "rmsd": null, "origin": [ -2.033, -1.633, 1.462 ], "x_axis": [ 0.088, 0.995, -0.035 ], "y_axis": [ -0.838, 0.093, 0.538 ], "z_axis": [ 0.539, -0.019, 0.842 ], "quaternion": [ 0.711, 0.196, 0.202, 0.644 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/23", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -121.790, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 25.379, "chi2": -132.085, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.426, "C1C1_dist": 11.765, "N1N9_dist": 9.907, "C6C8_dist": 9.676, "CNNC_torsion": 9.120, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.00],O6(carbonyl)-N1(imino)[2.85]", "interBase_angle": 3.485, "planarity": 0.068, "simple_Shear": -2.174, "simple_Stretch": 3.096, "simple_Buckle": -3.275, "simple_Propeller": 1.191, "bp_simpleParams": [ -2.174, 3.096, 0.210, -3.275, 1.191, 88.467 ], "bp_params": [ -2.271, -3.025, 0.210, -0.119, -3.483, 88.494 ], "frame": { "rmsd": null, "origin": [ -2.242, 0.995, 1.397 ], "x_axis": [ 0.828, -0.094, -0.553 ], "y_axis": [ 0.085, 0.995, -0.043 ], "z_axis": [ 0.555, -0.011, 0.832 ], "quaternion": [ 0.956, -0.008, 0.290, -0.047 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/10", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -113.552, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 66.149, "chi2": 63.169, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 27.108, "C1C1_dist": 11.681, "N1N9_dist": 9.787, "C6C8_dist": 9.500, "CNNC_torsion": 6.412, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.84],N2(amino)-N7[2.95]", "interBase_angle": 3.079, "planarity": 0.114, "simple_Shear": -2.365, "simple_Stretch": 2.863, "simple_Buckle": 1.255, "simple_Propeller": 2.812, "bp_simpleParams": [ -2.365, 2.863, -0.602, 1.255, 2.812, -90.239 ], "bp_params": [ 1.919, 3.179, -0.602, 3.069, -0.253, -90.219 ], "frame": { "rmsd": null, "origin": [ 1.005, -1.530, 3.369 ], "x_axis": [ -0.290, 0.929, 0.231 ], "y_axis": [ -0.757, -0.370, 0.538 ], "z_axis": [ 0.585, -0.019, 0.811 ], "quaternion": [ 0.536, 0.260, 0.165, 0.786 ] } }, { "index": 7, "nt1": "///A/6", "nt2": "///A/24", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -113.552, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 21.147, "chi2": -130.585, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 70.203, "C1C1_dist": 11.905, "N1N9_dist": 10.055, "C6C8_dist": 9.930, "CNNC_torsion": -2.248, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[3.12],O6(carbonyl)-N1(imino)[2.81],O6(carbonyl)-N2(amino)[3.11]", "interBase_angle": 15.276, "planarity": 0.234, "simple_Shear": -1.845, "simple_Stretch": 3.213, "simple_Buckle": 4.186, "simple_Propeller": 14.692, "bp_simpleParams": [ -1.845, 3.213, 0.491, 4.186, 14.692, 89.337 ], "bp_params": [ -2.623, -2.617, 0.491, -15.275, 0.198, 88.827 ], "frame": { "rmsd": null, "origin": [ -0.116, 0.507, 3.733 ], "x_axis": [ 0.740, 0.378, -0.556 ], "y_axis": [ -0.211, 0.916, 0.341 ], "z_axis": [ 0.639, -0.135, 0.758 ], "quaternion": [ 0.924, 0.129, 0.323, 0.160 ] } }, { "index": 8, "nt1": "///A/7", "nt2": "///A/25", "bp": "A+T", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -106.452, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 30.987, "chi2": -106.237, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.942, "C1C1_dist": 10.371, "N1N9_dist": 8.467, "C6C8_dist": 9.530, "CNNC_torsion": -128.939, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.02]", "interBase_angle": 33.589, "planarity": 0.599, "simple_Shear": 1.456, "simple_Stretch": 0.091, "simple_Buckle": 12.798, "simple_Propeller": 31.056, "bp_simpleParams": [ 1.456, 0.091, -1.134, 12.798, 31.056, 143.578 ], "bp_params": [ 0.155, 1.451, -1.134, -28.594, 17.624, 142.886 ], "frame": { "rmsd": null, "origin": [ 1.073, 1.719, 7.155 ], "x_axis": [ 0.483, 0.814, -0.322 ], "y_axis": [ -0.315, 0.505, 0.804 ], "z_axis": [ 0.817, -0.287, 0.500 ], "quaternion": [ 0.789, 0.346, 0.361, 0.358 ] } }, { "index": 9, "nt1": "///A/8", "nt2": "///A/25", "bp": "T+T", "name": "--", "Saenger": "13-XIII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -113.366, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.841, "chi2": -106.237, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.437, "C1C1_dist": 8.394, "N1N9_dist": 6.727, "C6C8_dist": 8.484, "CNNC_torsion": -152.798, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N3(imino)[3.12],N3(imino)-O2(carbonyl)[2.85]", "interBase_angle": 33.657, "planarity": 0.479, "simple_Shear": 3.814, "simple_Stretch": -0.717, "simple_Buckle": 22.373, "simple_Propeller": 25.144, "bp_simpleParams": [ 3.814, -0.717, 1.457, 22.373, 25.144, -176.825 ], "bp_params": [ -2.172, -3.216, 1.457, 14.248, -30.492, -176.911 ], "frame": { "rmsd": null, "origin": [ 2.016, 2.239, 8.605 ], "x_axis": [ -0.312, -0.950, 0.034 ], "y_axis": [ 0.418, -0.169, -0.893 ], "z_axis": [ 0.853, -0.264, 0.449 ], "quaternion": [ -0.492, 0.319, -0.416, 0.695 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///A/18", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 63.169, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 66.859, "chi2": -118.183, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 21.911, "C1C1_dist": 11.920, "N1N9_dist": 9.994, "C6C8_dist": 9.830, "CNNC_torsion": -2.292, "hbonds_num": 3, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.79],N2(amino)-N7[3.04],N2(amino)-O6(carbonyl)[3.17]", "interBase_angle": 5.662, "planarity": 0.078, "simple_Shear": -1.922, "simple_Stretch": 3.167, "simple_Buckle": -0.606, "simple_Propeller": -5.629, "bp_simpleParams": [ -1.922, 3.167, 0.205, -0.606, -5.629, -88.545 ], "bp_params": [ 2.524, 2.711, 0.205, -5.582, -0.950, -88.479 ], "frame": { "rmsd": null, "origin": [ 3.173, -0.122, 2.051 ], "x_axis": [ -0.781, -0.359, 0.512 ], "y_axis": [ 0.309, -0.933, -0.183 ], "z_axis": [ 0.543, 0.016, 0.839 ], "quaternion": [ -0.177, 0.280, -0.044, 0.942 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///A/17", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 60.326, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 65.680, "chi2": -99.089, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.330, "C1C1_dist": 11.690, "N1N9_dist": 9.779, "C6C8_dist": 9.503, "CNNC_torsion": -20.519, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.85],N2(amino)-N7[2.90]", "interBase_angle": 6.939, "planarity": 0.112, "simple_Shear": -2.258, "simple_Stretch": 3.073, "simple_Buckle": 3.527, "simple_Propeller": -5.976, "bp_simpleParams": [ -2.258, 3.073, 0.262, 3.527, -5.976, -86.797 ], "bp_params": [ 2.167, 3.138, 0.262, -4.497, -5.285, -86.814 ], "frame": { "rmsd": null, "origin": [ 0.175, -1.417, -0.023 ], "x_axis": [ -0.854, 0.106, 0.510 ], "y_axis": [ -0.084, -0.994, 0.066 ], "z_axis": [ 0.514, 0.014, 0.858 ], "quaternion": [ 0.049, 0.266, 0.021, 0.963 ] } }, { "index": 12, "nt1": "///A/12", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -116.253, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 21.744, "chi2": 80.988, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 61.135, "C1C1_dist": 12.036, "N1N9_dist": 9.970, "C6C8_dist": 9.713, "CNNC_torsion": -12.960, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.04],O6(carbonyl)-N1(imino)[2.80]", "interBase_angle": 5.557, "planarity": 0.081, "simple_Shear": -2.198, "simple_Stretch": 2.972, "simple_Buckle": 4.688, "simple_Propeller": -2.983, "bp_simpleParams": [ -2.198, 2.972, -0.226, 4.688, -2.983, 91.078 ], "bp_params": [ -2.162, -2.998, -0.226, 1.413, 5.374, 91.137 ], "frame": { "rmsd": null, "origin": [ -2.800, -1.428, -1.841 ], "x_axis": [ 0.614, 0.713, -0.338 ], "y_axis": [ 0.588, -0.699, -0.406 ], "z_axis": [ -0.526, 0.050, -0.849 ], "quaternion": [ -0.128, 0.889, 0.366, -0.243 ] } }, { "index": 13, "nt1": "///A/16", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 80.988, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 28.175, "chi2": 74.760, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 64.323, "C1C1_dist": 11.855, "N1N9_dist": 9.921, "C6C8_dist": 9.678, "CNNC_torsion": -7.393, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.98],O6(carbonyl)-N1(imino)[2.80]", "interBase_angle": 6.866, "planarity": 0.114, "simple_Shear": -2.162, "simple_Stretch": 3.007, "simple_Buckle": 5.226, "simple_Propeller": 4.454, "bp_simpleParams": [ -2.162, 3.007, 0.017, 5.226, 4.454, 89.867 ], "bp_params": [ -2.214, -2.969, 0.017, -5.824, 3.637, 89.822 ], "frame": { "rmsd": null, "origin": [ -1.167, 0.136, -3.110 ], "x_axis": [ -0.617, 0.693, 0.372 ], "y_axis": [ 0.556, 0.719, -0.417 ], "z_axis": [ -0.557, -0.050, -0.829 ], "quaternion": [ -0.261, 0.351, 0.890, -0.131 ] } }, { "index": 14, "nt1": "///A/17", "nt2": "///A/23", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -99.089, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.842, "chi2": -132.085, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 21.376, "C1C1_dist": 11.964, "N1N9_dist": 9.985, "C6C8_dist": 9.746, "CNNC_torsion": 1.061, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.80],N2(amino)-N7[3.10]", "interBase_angle": 8.052, "planarity": 0.137, "simple_Shear": -2.247, "simple_Stretch": 2.878, "simple_Buckle": 5.460, "simple_Propeller": 5.918, "bp_simpleParams": [ -2.247, 2.878, 0.024, 5.460, 5.918, -93.186 ], "bp_params": [ 2.056, 3.017, 0.024, 7.301, -3.396, -93.095 ], "frame": { "rmsd": null, "origin": [ -0.034, 1.211, -0.088 ], "x_axis": [ -0.080, -0.994, 0.075 ], "y_axis": [ 0.845, -0.108, -0.524 ], "z_axis": [ 0.529, 0.021, 0.848 ], "quaternion": [ 0.644, -0.212, 0.176, -0.713 ] } }, { "index": 15, "nt1": "///A/18", "nt2": "///A/24", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -118.183, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.965, "chi2": -130.585, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 28.516, "C1C1_dist": 11.642, "N1N9_dist": 9.725, "C6C8_dist": 9.469, "CNNC_torsion": -44.202, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.87],N2(amino)-N7[2.99]", "interBase_angle": 21.469, "planarity": 0.306, "simple_Shear": -2.373, "simple_Stretch": 2.800, "simple_Buckle": 21.221, "simple_Propeller": -3.255, "bp_simpleParams": [ -2.373, 2.800, 0.680, 21.221, -3.255, -91.144 ], "bp_params": [ 1.862, 3.163, 0.680, 3.951, -21.102, -92.086 ], "frame": { "rmsd": null, "origin": [ 2.052, 1.914, 2.416 ], "x_axis": [ 0.235, -0.926, -0.296 ], "y_axis": [ 0.764, 0.364, -0.533 ], "z_axis": [ 0.601, -0.101, 0.793 ], "quaternion": [ 0.773, -0.140, 0.290, -0.546 ] } }, { "index": 16, "nt1": "///A/20", "nt2": "///A/22", "bp": "A+G", "name": "--", "Saenger": "10-X", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -93.655, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 30.620, "chi2": 74.760, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 113.662, "C1C1_dist": 9.205, "N1N9_dist": 8.673, "C6C8_dist": 9.843, "CNNC_torsion": -103.859, "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[2.94]", "interBase_angle": 41.385, "planarity": 0.644, "simple_Shear": 2.238, "simple_Stretch": 4.553, "simple_Buckle": 28.411, "simple_Propeller": 30.092, "bp_simpleParams": [ 2.238, 4.553, -1.746, 28.411, 30.092, 67.721 ], "bp_params": [ -3.128, 3.995, -1.746, -14.803, 38.647, 70.394 ], "frame": { "rmsd": null, "origin": [ 1.369, 2.585, -4.363 ], "x_axis": [ -0.498, 0.546, 0.674 ], "y_axis": [ 0.496, 0.816, -0.296 ], "z_axis": [ -0.712, 0.187, -0.677 ], "quaternion": [ -0.400, 0.301, 0.865, -0.032 ] } } ], "num_multiplets": 3, "multiplets": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/5,///A/11,///A/17,///A/23", "planarity": 0.141 }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/6,///A/10,///A/18,///A/24", "planarity": 0.259 }, { "index": 3, "num_nts": 5, "nts_short": "GGGAG", "nts_long": "///A/4,///A/12,///A/16,///A/20,///A/22", "planarity": 0.421 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 0, "strand1": "GGGT", "strand2": "GGGT", "bp_type": "....", "helix_form": "..x", "helical_rise": 4.434, "helical_rise_std": 0.647, "helical_radius": 8.164, "helical_radius_std": 2.450, "helical_axis": [ 0.304, -0.336, 0.892 ], "point1": [ -4.765, 5.710, -1.850 ], "point2": [ -0.606, 1.112, 10.351 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/4", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 2.136, 3.031, -0.162, 0.754, -4.517, -90.024 ], "step_params": [ -2.137, -0.682, 3.178, 5.494, -1.018, -51.507 ], "heli_params": [ 0.849, -2.075, 3.361, 1.168, 6.301, -51.789 ], "bp2_params": [ -2.271, -3.025, 0.210, -0.119, -3.483, 88.494 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.178, "simple_Twist": 15.234, "simple_hRise": 2.309, "simple_hTwist": 16.221 }, { "index": 2, "nt1": "///A/5", "nt2": "///A/23", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -2.271, -3.025, 0.210, -0.119, -3.483, 88.494 ], "step_params": [ 0.257, -0.298, 3.172, 7.977, 5.301, 27.375 ], "heli_params": [ -1.736, 1.203, 3.017, 10.790, -16.238, 28.972 ], "bp2_params": [ -2.623, -2.617, 0.491, -15.275, 0.198, 88.827 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.172, "simple_Twist": 24.757, "simple_hRise": 2.982, "simple_hTwist": 26.518 }, { "index": 3, "nt1": "///A/6", "nt2": "///A/24", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -2.623, -2.617, 0.491, -15.275, 0.198, 88.827 ], "step_params": [ -3.575, 0.510, 4.271, -7.784, 21.558, -127.010 ], "heli_params": [ -0.499, -2.066, 4.083, -12.005, -4.335, -128.146 ], "bp2_params": [ -2.172, -3.216, 1.457, 14.248, -30.492, -176.911 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.271, "simple_Twist": 33.460, "simple_hRise": 4.497, "simple_hTwist": 40.372 }, { "index": 4, "nt1": "///A/8", "nt2": "///A/25", "bp": "T+T", "name": "--", "Saenger": "13-XIII", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 2, "num_stems": 0, "strand1": "GGGA", "strand2": "GGGT", "bp_type": "....", "helix_form": "..x", "helical_rise": 3.296, "helical_rise_std": 0.381, "helical_radius": 9.382, "helical_radius_std": 1.400, "helical_axis": [ -0.451, -0.047, -0.891 ], "point1": [ 1.803, -1.145, 2.279 ], "point2": [ -2.681, -1.615, -6.593 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/10", "nt2": "///A/18", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 2.524, 2.711, 0.205, -5.582, -0.950, -88.479 ], "step_params": [ -1.598, 1.047, 3.365, -0.159, 2.003, 27.142 ], "heli_params": [ 1.702, 3.355, 3.440, 4.261, 0.337, 27.215 ], "bp2_params": [ 2.167, 3.138, 0.262, -4.497, -5.285, -86.814 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.365, "simple_Twist": 24.162, "simple_hRise": 3.449, "simple_hTwist": 24.244 }, { "index": 2, "nt1": "///A/11", "nt2": "///A/17", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 2.167, 3.138, 0.262, -4.497, -5.285, -86.814 ], "step_params": [ -1.524, -0.475, 3.099, 3.761, 0.426, -51.641 ], "heli_params": [ 0.516, -1.501, 3.199, -0.489, 4.311, -51.770 ], "bp2_params": [ -2.162, -2.998, -0.226, 1.413, 5.374, 91.137 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.099, "simple_Twist": 16.369, "simple_hRise": 2.669, "simple_hTwist": 16.798 }, { "index": 3, "nt1": "///A/12", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -2.162, -2.998, -0.226, 1.413, 5.374, 91.137 ], "step_params": [ 0.884, 0.378, 2.486, 6.307, 1.339, -44.458 ], "heli_params": [ -0.585, 1.580, 2.334, -1.759, 8.284, -44.900 ], "bp2_params": [ -0.152, 1.293, -0.709, -5.048, -39.726, 170.779 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.486, "simple_Twist": 81.391, "simple_hRise": 2.542, "simple_hTwist": 81.602 }, { "index": 4, "nt1": "///A/3", "nt2": "///A/15", "bp": "A+T", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 3, "nts_short": "TTT", "nts_long": "///A/1,///A/21,///A/19" }, { "index": 2, "num_nts": 4, "nts_short": "TGGG", "nts_long": "///A/9,///A/18,///A/17,///A/16" }, { "index": 3, "num_nts": 4, "nts_short": "GGGT", "nts_long": "///A/10,///A/11,///A/12,///A/15" }, { "index": 4, "num_nts": 5, "nts_short": "GGGAT", "nts_long": "///A/4,///A/5,///A/6,///A/7,///A/8" }, { "index": 5, "num_nts": 8, "nts_short": "ATAGGGTT", "nts_long": "///A/14,///A/2,///A/3,///A/22,///A/23,///A/24,///A/25,///A/26" } ], "nonStack": { "num_nts": 1, "nts_short": "A", "nts_long": "///A/13" }, "num_ssSegments": 1, "ssSegments": [ { "index": 1, "num_nts": 26, "nts_short": "TTAGGGATTGGGAATGGGTATGGGTT", "nts_long": "///A/1,///A/2,///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26" } ], "num_Gtetrads": 3, "Gtetrads": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/4,///A/12,///A/16,///A/22", "planarity": 0.177, "G1G2_simpleParams": [ -2.131, 3.052, 0.331, 7.542, 4.582, 88.666 ], "G2G3_simpleParams": [ -2.198, 2.972, -0.226, 4.688, -2.983, 91.078 ], "G3G4_simpleParams": [ -2.162, 3.007, 0.017, 5.226, 4.454, 89.867 ], "G4G1_simpleParams": [ -2.218, 2.971, 0.162, 4.528, -0.686, 89.981 ], "type": "bowl-2", "direction": "Major-->WC", "ONZ_class": "O-", "glyco_bond": "s-ss", "sugar_pucker": "----", "groove_type": "wn--", "groove_distPP": [ 19.840, 10.776, 15.972, 12.915 ], "rmsd": 0.236, "frame": { "rmsd": null, "origin": [ -2.787, 0.418, -2.223 ], "x_axis": [ -0.824, -0.215, 0.524 ], "y_axis": [ -0.191, 0.977, 0.100 ], "z_axis": [ -0.534, -0.017, -0.846 ], "quaternion": [ -0.277, -0.106, 0.955, 0.022 ] } }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/5,///A/11,///A/17,///A/23", "planarity": 0.141, "G1G2_simpleParams": [ -2.225, 3.008, -0.154, -1.578, -1.022, -91.693 ], "G2G3_simpleParams": [ -2.258, 3.073, 0.262, 3.527, -5.976, -86.797 ], "G3G4_simpleParams": [ -2.247, 2.878, 0.024, 5.460, 5.918, -93.186 ], "G4G1_simpleParams": [ -2.174, 3.096, -0.210, -3.275, 1.191, -88.467 ], "type": "planar", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "-s--", "sugar_pucker": "---3", "groove_type": "wn--", "groove_distPP": [ 22.022, 8.760, 17.511, 16.909 ], "rmsd": 0.232, "frame": { "rmsd": null, "origin": [ -1.020, -0.227, 0.726 ], "x_axis": [ 0.746, 0.470, -0.472 ], "y_axis": [ -0.398, 0.883, 0.250 ], "z_axis": [ 0.534, 0.001, 0.845 ], "quaternion": [ 0.932, 0.067, 0.270, 0.233 ] } }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/6,///A/10,///A/18,///A/24", "planarity": 0.259, "G1G2_simpleParams": [ -2.365, 2.863, -0.602, 1.255, 2.812, -90.239 ], "G2G3_simpleParams": [ -1.922, 3.167, 0.205, -0.606, -5.629, -88.545 ], "G3G4_simpleParams": [ -2.373, 2.800, 0.680, 21.221, -3.255, -91.144 ], "G4G1_simpleParams": [ -1.845, 3.213, -0.491, 4.186, 14.692, -89.337 ], "type": "other", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "-s--", "sugar_pucker": "---3", "groove_type": "wn--", "groove_distPP": [ 21.741, 8.378, 15.917, 18.018 ], "rmsd": 0.385, "frame": { "rmsd": null, "origin": [ 1.674, 0.150, 3.095 ], "x_axis": [ 0.494, 0.814, -0.305 ], "y_axis": [ -0.635, 0.578, 0.513 ], "z_axis": [ 0.594, -0.060, 0.803 ], "quaternion": [ 0.848, 0.169, 0.265, 0.427 ] } } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/1,///A/2" } ], "dbn": { "all_chains": { "num_nts": 26, "num_chars": 26, "bseq": "TTAGGGATTGGGAATGGGTATGGGTT", "sstr": "..........................", "form": "......B.Z.......B.....B..-" }, "m1_chain_A": { "num_nts": 26, "num_chars": 26, "bseq": "TTAGGGATTGGGAATGGGTATGGGTT", "sstr": "..........................", "form": "......B.Z.......B.....B..-" } }, "chains": { "m1_chain_A": { "num_nts": 26, "bseq": "TTAGGGATTGGGAATGGGTATGGGTT", "sstr": "..........................", "form": "......B.Z.......B.....B..-", "helical_rise": 0.047, "helical_rise_std": 2.155, "helical_axis": [ 0.101, 0.995, -0.024 ], "point1": [ 0.199, 1.099, -1.863 ], "point2": [ 0.261, 1.711, -1.877 ], "num_chars": 76, "suite": "T5zT!!A4bG!!G!!G!!A!!T4bT!!G!!G!!G2zA2oA!!T!!G!!G4bG!!T!!A2zT!!G!!G1aG1bT!!T" } }, "num_nts": 26, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop,splayed-apart", "alpha": null, "beta": null, "gamma": 59.409, "delta": 103.977, "epsilon": -147.175, "zeta": 57.144, "epsilon_zeta": 155.681, "bb_type": "--", "chi": -132.127, "glyco_bond": "anti", "C5prime_xyz": [ -2.977, 8.741, -1.172 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.961, "Dp": 2.852, "splay_angle": 89.263, "splay_distance": 14.415, "splay_ratio": 0.703, "d22": 6.040, "d64": 7.198, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -38.593, "v1": 27.687, "v2": -7.786, "v3": -14.494, "v4": 33.639, "amplitude": 37.982, "phase_angle": 101.830, "puckering": "O4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.095, "frame": { "rmsd": 0.027, "origin": [ 2.423, -3.622, -13.806 ], "x_axis": [ -0.092, -0.810, 0.579 ], "y_axis": [ -0.664, 0.483, 0.571 ], "z_axis": [ -0.742, -0.332, -0.582 ], "quaternion": [ -0.450, -0.502, 0.734, 0.081 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 177.356, "beta": 172.275, "gamma": 54.036, "delta": 132.627, "epsilon": -168.608, "zeta": -85.469, "epsilon_zeta": -83.139, "bb_type": "BI", "chi": -116.954, "glyco_bond": "anti", "C5prime_xyz": [ -2.834, 8.465, -1.883 ], "P_xyz": [ -0.952, 10.279, -1.553 ], "form": ".", "ssZp": 1.500, "Dp": 2.385, "splay_angle": 30.526, "splay_distance": 5.037, "splay_ratio": 0.265, "d22": null, "d64": null, "eta": 66.131, "theta": -124.011, "eta_prime": 123.037, "theta_prime": -131.625, "eta_base": 145.861, "theta_base": -64.303, "v0": -37.147, "v1": 45.565, "v2": -35.800, "v3": 15.627, "v4": 13.225, "amplitude": 44.301, "phase_angle": 143.912, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.041, "filter_rmsd": 0.098, "frame": { "rmsd": 0.039, "origin": [ -8.323, -0.724, -4.645 ], "x_axis": [ 0.580, -0.814, -0.039 ], "y_axis": [ 0.490, 0.387, -0.781 ], "z_axis": [ 0.651, 0.434, 0.623 ], "quaternion": [ 0.805, -0.378, 0.214, -0.405 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -68.091, "beta": 171.923, "gamma": 54.760, "delta": 138.285, "epsilon": -155.563, "zeta": 166.060, "epsilon_zeta": 38.378, "bb_type": "--", "chi": -85.045, "glyco_bond": "anti", "C5prime_xyz": [ -3.481, 7.516, -2.614 ], "P_xyz": [ -1.542, 8.942, -3.703 ], "form": ".", "ssZp": 1.968, "Dp": 2.228, "splay_angle": 24.292, "splay_distance": 4.769, "splay_ratio": 0.297, "d22": null, "d64": null, "eta": 165.913, "theta": 139.194, "eta_prime": -155.356, "theta_prime": 135.784, "eta_base": -84.483, "theta_base": -176.416, "v0": -35.263, "v1": 45.465, "v2": -37.334, "v3": 18.193, "v4": 10.612, "amplitude": 44.257, "phase_angle": 147.520, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.052, "frame": { "rmsd": 0.027, "origin": [ -3.300, -0.428, -4.887 ], "x_axis": [ 0.780, -0.073, -0.621 ], "y_axis": [ -0.089, 0.970, -0.226 ], "z_axis": [ 0.619, 0.232, 0.750 ], "quaternion": [ 0.936, -0.122, 0.331, 0.004 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,phosphate", "alpha": -70.252, "beta": 160.313, "gamma": 52.169, "delta": 141.944, "epsilon": 176.191, "zeta": -85.421, "epsilon_zeta": -98.388, "bb_type": "BI", "chi": 70.083, "glyco_bond": "syn", "C5prime_xyz": [ -5.344, 4.667, 1.741 ], "P_xyz": [ -5.706, 2.037, 1.706 ], "form": ".", "ssZp": -2.147, "Dp": 2.326, "splay_angle": 25.830, "splay_distance": 4.577, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 164.437, "theta": -116.793, "eta_prime": 176.955, "theta_prime": -142.461, "eta_base": -143.571, "theta_base": -170.541, "v0": -25.701, "v1": 40.573, "v2": -38.249, "v3": 25.110, "v4": 0.014, "amplitude": 40.522, "phase_angle": 160.721, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.218, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ -4.043, 2.544, -1.232 ], "x_axis": [ 0.050, -0.998, 0.041 ], "y_axis": [ -0.857, -0.022, 0.514 ], "z_axis": [ -0.512, -0.061, -0.857 ], "quaternion": [ 0.207, 0.694, -0.668, -0.170 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -65.286, "beta": 172.052, "gamma": 58.536, "delta": 120.501, "epsilon": -175.152, "zeta": -96.944, "epsilon_zeta": -78.208, "bb_type": "BI", "chi": -121.790, "glyco_bond": "anti", "C5prime_xyz": [ -2.772, 8.714, -1.551 ], "P_xyz": [ -0.699, 10.347, -1.653 ], "form": ".", "ssZp": 2.379, "Dp": 2.518, "splay_angle": 18.596, "splay_distance": 3.394, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 172.056, "theta": -152.527, "eta_prime": -158.335, "theta_prime": -160.756, "eta_base": -168.202, "theta_base": -132.307, "v0": -37.655, "v1": 40.280, "v2": -27.670, "v3": 6.372, "v4": 19.711, "amplitude": 40.560, "phase_angle": 133.015, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ -3.252, -0.405, 2.178 ], "x_axis": [ 0.663, 0.627, -0.409 ], "y_axis": [ -0.529, 0.779, 0.336 ], "z_axis": [ 0.529, -0.007, 0.848 ], "quaternion": [ 0.907, 0.095, 0.259, 0.318 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -68.350, "beta": 179.679, "gamma": 51.857, "delta": 127.835, "epsilon": -179.560, "zeta": -92.171, "epsilon_zeta": -87.389, "bb_type": "BI", "chi": -113.552, "glyco_bond": "anti", "C5prime_xyz": [ -2.980, 8.518, -1.656 ], "P_xyz": [ -1.085, 10.347, -1.665 ], "form": ".", "ssZp": 2.471, "Dp": 2.493, "splay_angle": 30.113, "splay_distance": 4.903, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 166.712, "theta": -143.096, "eta_prime": -171.627, "theta_prime": -148.562, "eta_base": -136.999, "theta_base": -74.727, "v0": -35.233, "v1": 42.437, "v2": -32.502, "v3": 12.827, "v4": 13.991, "amplitude": 41.382, "phase_angle": 141.758, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ -0.653, -1.221, 4.202 ], "x_axis": [ 0.322, 0.918, -0.232 ], "y_axis": [ -0.727, 0.397, 0.560 ], "z_axis": [ 0.606, -0.011, 0.795 ], "quaternion": [ 0.793, 0.180, 0.264, 0.519 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,ss-non-loop", "alpha": -60.422, "beta": 168.998, "gamma": 64.703, "delta": 133.280, "epsilon": 171.675, "zeta": -93.592, "epsilon_zeta": -94.733, "bb_type": "BI", "chi": -106.452, "glyco_bond": "anti", "C5prime_xyz": [ -2.529, 8.264, -1.940 ], "P_xyz": [ -0.137, 9.255, -2.394 ], "form": "B", "ssZp": 2.172, "Dp": 2.237, "splay_angle": 21.109, "splay_distance": 3.613, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 170.796, "theta": -140.154, "eta_prime": -147.095, "theta_prime": -161.714, "eta_base": -68.465, "theta_base": -105.386, "v0": -27.557, "v1": 37.972, "v2": -33.007, "v3": 17.796, "v4": 6.040, "amplitude": 37.346, "phase_angle": 152.106, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.034, "origin": [ 0.419, 2.311, 7.429 ], "x_axis": [ -0.374, 0.783, 0.498 ], "y_axis": [ -0.505, -0.622, 0.599 ], "z_axis": [ 0.778, -0.027, 0.628 ], "quaternion": [ 0.397, 0.394, 0.176, 0.810 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -61.933, "beta": 174.311, "gamma": 62.015, "delta": 140.623, "epsilon": -167.540, "zeta": 145.249, "epsilon_zeta": 47.211, "bb_type": "--", "chi": -113.366, "glyco_bond": "anti", "C5prime_xyz": [ -2.705, 8.455, -1.688 ], "P_xyz": [ -0.491, 9.880, -1.666 ], "form": ".", "ssZp": 2.063, "Dp": 2.338, "splay_angle": 72.399, "splay_distance": 10.513, "splay_ratio": 0.591, "d22": 8.397, "d64": 9.749, "eta": 174.731, "theta": 115.075, "eta_prime": -155.030, "theta_prime": 117.308, "eta_base": -93.503, "theta_base": 148.120, "v0": -32.632, "v1": 43.330, "v2": -36.933, "v3": 19.442, "v4": 8.148, "amplitude": 42.492, "phase_angle": 150.364, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.028, "origin": [ 2.304, 3.350, 10.331 ], "x_axis": [ -0.526, 0.158, 0.835 ], "y_axis": [ -0.069, -0.987, 0.143 ], "z_axis": [ 0.847, 0.017, 0.531 ], "quaternion": [ 0.065, 0.482, 0.046, 0.872 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -59.971, "beta": 175.580, "gamma": 59.180, "delta": 153.371, "epsilon": -83.329, "zeta": 66.784, "epsilon_zeta": 209.887, "bb_type": "--", "chi": -158.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.814, 8.357, 0.976 ], "P_xyz": [ -0.039, 8.033, 2.898 ], "form": "Z", "ssZp": -0.185, "Dp": 0.768, "splay_angle": 43.938, "splay_distance": 7.190, "splay_ratio": 0.381, "d22": null, "d64": null, "eta": -133.289, "theta": 121.536, "eta_prime": -136.258, "theta_prime": 79.816, "eta_base": -158.241, "theta_base": 66.673, "v0": -4.014, "v1": 25.280, "v2": -35.139, "v3": 34.099, "v4": -19.181, "amplitude": 35.993, "phase_angle": 192.506, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.017, "filter_rmsd": 0.097, "frame": { "rmsd": 0.033, "origin": [ 8.846, 1.820, 2.244 ], "x_axis": [ -0.615, 0.636, 0.465 ], "y_axis": [ -0.504, -0.771, 0.388 ], "z_axis": [ 0.606, 0.004, 0.795 ], "quaternion": [ 0.320, 0.300, 0.110, 0.892 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": 77.371, "beta": -179.205, "gamma": -164.273, "delta": 141.731, "epsilon": 175.927, "zeta": -93.708, "epsilon_zeta": -90.365, "bb_type": "BI", "chi": 63.169, "glyco_bond": "syn", "C5prime_xyz": [ -5.675, 4.911, 1.216 ], "P_xyz": [ -7.035, 3.960, 3.299 ], "form": ".", "ssZp": -2.354, "Dp": 2.671, "splay_angle": 25.268, "splay_distance": 4.042, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 160.031, "theta": 173.668, "eta_prime": 152.982, "theta_prime": 176.748, "eta_base": 159.490, "theta_base": -168.827, "v0": -33.290, "v1": 46.685, "v2": -40.866, "v3": 23.472, "v4": 5.702, "amplitude": 45.591, "phase_angle": 153.684, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 2.663, -1.838, 2.536 ], "x_axis": [ -0.753, 0.394, 0.528 ], "y_axis": [ -0.339, -0.919, 0.202 ], "z_axis": [ 0.564, -0.027, 0.825 ], "quaternion": [ 0.196, 0.292, 0.047, 0.935 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -72.086, "beta": -162.998, "gamma": 46.179, "delta": 128.192, "epsilon": -175.357, "zeta": -86.118, "epsilon_zeta": -89.239, "bb_type": "BI", "chi": 60.326, "glyco_bond": "syn", "C5prime_xyz": [ -5.744, 5.231, 1.555 ], "P_xyz": [ -7.637, 3.439, 1.040 ], "form": ".", "ssZp": -2.349, "Dp": 2.713, "splay_angle": 23.408, "splay_distance": 4.154, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 172.757, "theta": -138.971, "eta_prime": -172.876, "theta_prime": -139.274, "eta_base": -152.480, "theta_base": -154.799, "v0": -40.190, "v1": 48.177, "v2": -36.557, "v3": 14.398, "v4": 15.919, "amplitude": 46.791, "phase_angle": 141.378, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ -0.814, -2.861, 0.746 ], "x_axis": [ -0.531, 0.760, 0.376 ], "y_axis": [ -0.646, -0.650, 0.401 ], "z_axis": [ 0.549, -0.030, 0.835 ], "quaternion": [ 0.405, 0.266, 0.107, 0.868 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -67.364, "beta": 169.201, "gamma": 57.775, "delta": 135.754, "epsilon": -130.621, "zeta": -87.388, "epsilon_zeta": -43.233, "bb_type": "--", "chi": -116.253, "glyco_bond": "anti", "C5prime_xyz": [ -3.165, 8.555, -1.426 ], "P_xyz": [ -1.164, 10.270, -1.579 ], "form": ".", "ssZp": 2.062, "Dp": 1.972, "splay_angle": 32.459, "splay_distance": 5.331, "splay_ratio": 0.280, "d22": null, "d64": null, "eta": 178.430, "theta": -87.614, "eta_prime": -149.682, "theta_prime": -132.093, "eta_base": -160.066, "theta_base": -145.616, "v0": -37.396, "v1": 45.535, "v2": -35.595, "v3": 15.307, "v4": 13.600, "amplitude": 44.311, "phase_angle": 143.445, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ -4.286, -1.156, -0.770 ], "x_axis": [ 0.862, -0.002, -0.506 ], "y_axis": [ -0.048, -0.996, -0.079 ], "z_axis": [ -0.504, 0.092, -0.859 ], "quaternion": [ -0.044, 0.964, -0.013, -0.262 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-stack,non-pair-contact,ss-non-loop", "alpha": -168.605, "beta": 166.892, "gamma": 64.377, "delta": 150.084, "epsilon": -141.648, "zeta": -76.538, "epsilon_zeta": -65.110, "bb_type": "BI", "chi": -131.402, "glyco_bond": "anti", "C5prime_xyz": [ -2.045, 8.648, -0.588 ], "P_xyz": [ 0.384, 9.391, 0.121 ], "form": ".", "ssZp": 1.341, "Dp": 1.747, "splay_angle": 51.178, "splay_distance": 9.347, "splay_ratio": 0.442, "d22": null, "d64": null, "eta": 63.234, "theta": -81.125, "eta_prime": 123.799, "theta_prime": -128.649, "eta_base": 137.745, "theta_base": -146.597, "v0": -20.776, "v1": 37.999, "v2": -39.229, "v3": 29.080, "v4": -5.456, "amplitude": 40.012, "phase_angle": 168.648, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.601, "filter_rmsd": 0.052, "frame": { "rmsd": 0.031, "origin": [ -8.482, 0.125, -3.798 ], "x_axis": [ 0.516, 0.183, 0.837 ], "y_axis": [ -0.290, -0.882, 0.371 ], "z_axis": [ 0.806, -0.435, -0.402 ], "quaternion": [ 0.241, 0.837, -0.032, 0.491 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -70.216, "beta": -171.270, "gamma": -62.884, "delta": 137.163, "epsilon": -158.508, "zeta": -87.494, "epsilon_zeta": -71.013, "bb_type": "BI", "chi": -117.047, "glyco_bond": "anti", "C5prime_xyz": [ -2.604, 8.471, -1.679 ], "P_xyz": [ -3.132, 11.021, -2.212 ], "form": ".", "ssZp": 1.466, "Dp": 2.093, "splay_angle": 58.601, "splay_distance": 9.246, "splay_ratio": 0.489, "d22": null, "d64": null, "eta": 75.938, "theta": -160.566, "eta_prime": 98.429, "theta_prime": -142.276, "eta_base": 99.731, "theta_base": -93.238, "v0": -32.604, "v1": 43.192, "v2": -36.642, "v3": 19.058, "v4": 8.233, "amplitude": 42.288, "phase_angle": 150.053, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "2o", "suiteness": 0.179, "filter_rmsd": 0.053, "frame": { "rmsd": 0.031, "origin": [ -5.552, -0.413, -12.657 ], "x_axis": [ -0.333, 0.917, 0.217 ], "y_axis": [ -0.594, -0.383, 0.707 ], "z_axis": [ 0.732, 0.107, 0.673 ], "quaternion": [ 0.489, 0.307, 0.263, 0.773 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -61.674, "beta": -176.828, "gamma": 58.397, "delta": 139.208, "epsilon": -163.695, "zeta": -82.904, "epsilon_zeta": -80.790, "bb_type": "BI", "chi": -110.349, "glyco_bond": "anti", "C5prime_xyz": [ -2.045, 8.397, -1.613 ], "P_xyz": [ 0.353, 9.397, -1.169 ], "form": ".", "ssZp": 1.863, "Dp": 2.074, "splay_angle": 16.267, "splay_distance": 2.873, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": -178.500, "theta": -140.364, "eta_prime": -137.677, "theta_prime": -169.105, "eta_base": -88.063, "theta_base": -147.818, "v0": -19.105, "v1": 32.638, "v2": -32.296, "v3": 22.409, "v4": -2.339, "amplitude": 33.466, "phase_angle": 164.805, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.030, "origin": [ -3.916, -0.669, -3.560 ], "x_axis": [ -0.840, -0.068, 0.538 ], "y_axis": [ -0.189, -0.893, -0.408 ], "z_axis": [ 0.508, -0.444, 0.738 ], "quaternion": [ 0.033, 0.281, -0.229, 0.932 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -55.143, "beta": -87.872, "gamma": -70.341, "delta": 162.202, "epsilon": -177.278, "zeta": -80.985, "epsilon_zeta": -96.292, "bb_type": "BI", "chi": 80.988, "glyco_bond": "syn", "C5prime_xyz": [ -4.542, 4.153, 1.940 ], "P_xyz": [ -6.532, 4.193, 3.674 ], "form": ".", "ssZp": -1.503, "Dp": 1.689, "splay_angle": 21.239, "splay_distance": 3.689, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 174.066, "theta": -173.539, "eta_prime": 164.737, "theta_prime": -157.128, "eta_base": -163.717, "theta_base": -179.417, "v0": -2.132, "v1": 26.578, "v2": -38.295, "v3": 38.986, "v4": -23.597, "amplitude": 39.845, "phase_angle": 196.035, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ -1.314, -1.699, -2.911 ], "x_axis": [ -0.013, 1.000, 0.018 ], "y_axis": [ 0.837, 0.021, -0.547 ], "z_axis": [ -0.547, 0.008, -0.837 ], "quaternion": [ -0.207, 0.672, 0.684, -0.197 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -67.318, "beta": 165.100, "gamma": 52.925, "delta": 138.607, "epsilon": -98.712, "zeta": 166.453, "epsilon_zeta": 94.836, "bb_type": "BII", "chi": -99.089, "glyco_bond": "anti", "C5prime_xyz": [ -3.437, 8.215, -1.741 ], "P_xyz": [ -1.432, 9.694, -2.644 ], "form": "B", "ssZp": 1.982, "Dp": 1.334, "splay_angle": 22.280, "splay_distance": 3.790, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -178.940, "theta": 167.771, "eta_prime": -143.513, "theta_prime": 165.731, "eta_base": -165.031, "theta_base": -160.236, "v0": -35.513, "v1": 44.770, "v2": -36.243, "v3": 17.021, "v4": 11.465, "amplitude": 43.624, "phase_angle": 146.181, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.033, "frame": { "rmsd": 0.033, "origin": [ 1.164, 0.027, -0.791 ], "x_axis": [ -0.681, -0.606, 0.410 ], "y_axis": [ 0.556, -0.793, -0.250 ], "z_axis": [ 0.477, 0.058, 0.877 ], "quaternion": [ -0.317, 0.242, -0.052, 0.915 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": -82.093, "beta": 146.096, "gamma": 45.804, "delta": 142.648, "epsilon": -94.926, "zeta": 58.745, "epsilon_zeta": 206.329, "bb_type": "--", "chi": -118.183, "glyco_bond": "anti", "C5prime_xyz": [ -2.288, 8.633, -1.259 ], "P_xyz": [ 0.251, 9.324, -0.951 ], "form": ".", "ssZp": 1.108, "Dp": 1.042, "splay_angle": 71.310, "splay_distance": 12.214, "splay_ratio": 0.583, "d22": null, "d64": null, "eta": -169.446, "theta": 102.224, "eta_prime": -160.202, "theta_prime": 64.231, "eta_base": -132.534, "theta_base": 41.431, "v0": -24.038, "v1": 37.624, "v2": -35.537, "v3": 22.956, "v4": 0.456, "amplitude": 37.746, "phase_angle": 160.299, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.512, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 3.683, 1.594, 1.567 ], "x_axis": [ -0.329, -0.907, 0.263 ], "y_axis": [ 0.788, -0.417, -0.454 ], "z_axis": [ 0.521, 0.058, 0.851 ], "quaternion": [ 0.526, -0.243, 0.123, -0.806 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 84.413, "beta": -174.241, "gamma": -175.181, "delta": 145.905, "epsilon": -172.120, "zeta": -78.949, "epsilon_zeta": -93.171, "bb_type": "BI", "chi": -117.556, "glyco_bond": "anti", "C5prime_xyz": [ -2.970, 8.631, -1.024 ], "P_xyz": [ -2.084, 10.111, -3.046 ], "form": ".", "ssZp": 2.446, "Dp": 2.618, "splay_angle": 50.674, "splay_distance": 7.709, "splay_ratio": 0.429, "d22": null, "d64": null, "eta": 146.853, "theta": -148.923, "eta_prime": 152.741, "theta_prime": -141.539, "eta_base": 132.070, "theta_base": -64.768, "v0": -34.321, "v1": 48.738, "v2": -43.046, "v3": 24.588, "v4": 5.821, "amplitude": 47.846, "phase_angle": 154.113, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.095, "frame": { "rmsd": 0.034, "origin": [ 7.004, -2.518, -9.444 ], "x_axis": [ -0.789, -0.230, 0.569 ], "y_axis": [ 0.222, 0.758, 0.614 ], "z_axis": [ -0.573, 0.611, -0.547 ], "quaternion": [ -0.325, -0.002, 0.879, 0.348 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -67.384, "beta": 165.990, "gamma": 62.686, "delta": 147.262, "epsilon": -179.573, "zeta": -85.992, "epsilon_zeta": -93.581, "bb_type": "BI", "chi": -93.655, "glyco_bond": "anti", "C5prime_xyz": [ -2.824, 7.919, -2.237 ], "P_xyz": [ -0.416, 8.804, -2.936 ], "form": ".", "ssZp": 2.293, "Dp": 2.326, "splay_angle": 31.490, "splay_distance": 5.162, "splay_ratio": 0.273, "d22": null, "d64": null, "eta": 153.270, "theta": -87.730, "eta_prime": -141.620, "theta_prime": -157.296, "eta_base": -61.896, "theta_base": 147.759, "v0": -25.369, "v1": 41.863, "v2": -40.868, "v3": 27.799, "v4": -1.832, "amplitude": 42.655, "phase_angle": 163.356, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.052, "frame": { "rmsd": 0.028, "origin": [ 3.759, 3.198, -5.416 ], "x_axis": [ 0.141, 0.803, 0.579 ], "y_axis": [ 0.626, 0.381, -0.681 ], "z_axis": [ -0.767, 0.458, -0.449 ], "quaternion": [ 0.518, -0.550, -0.650, 0.086 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 172.343, "beta": -174.565, "gamma": 52.608, "delta": 145.601, "epsilon": -162.024, "zeta": -75.515, "epsilon_zeta": -86.509, "bb_type": "BI", "chi": -136.651, "glyco_bond": "anti", "C5prime_xyz": [ -1.967, 8.758, -0.463 ], "P_xyz": [ 0.145, 9.700, 0.849 ], "form": ".", "ssZp": 1.919, "Dp": 2.236, "splay_angle": 28.313, "splay_distance": 4.718, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 44.254, "theta": -119.539, "eta_prime": 77.746, "theta_prime": -150.770, "eta_base": 49.905, "theta_base": -168.525, "v0": -21.846, "v1": 38.231, "v2": -38.376, "v3": 26.998, "v4": -3.594, "amplitude": 39.554, "phase_angle": 165.983, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.010, "filter_rmsd": 0.096, "frame": { "rmsd": 0.039, "origin": [ 0.672, -0.696, -6.814 ], "x_axis": [ 0.452, -0.884, -0.120 ], "y_axis": [ 0.449, 0.342, -0.826 ], "z_axis": [ 0.771, 0.319, 0.551 ], "quaternion": [ 0.766, -0.374, 0.291, -0.435 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": -73.063, "beta": -94.191, "gamma": -64.324, "delta": 147.990, "epsilon": -176.320, "zeta": -79.874, "epsilon_zeta": -96.446, "bb_type": "BI", "chi": 74.760, "glyco_bond": "syn", "C5prime_xyz": [ -5.144, 4.800, 2.072 ], "P_xyz": [ -7.170, 5.860, 3.422 ], "form": ".", "ssZp": -1.865, "Dp": 2.289, "splay_angle": 21.168, "splay_distance": 3.954, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 149.945, "theta": 179.767, "eta_prime": 145.044, "theta_prime": -166.881, "eta_base": 146.528, "theta_base": 179.153, "v0": -26.472, "v1": 43.064, "v2": -41.330, "v3": 27.864, "v4": -1.267, "amplitude": 43.365, "phase_angle": 162.378, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ -1.021, 1.972, -3.310 ], "x_axis": [ -0.822, -0.016, 0.569 ], "y_axis": [ -0.075, 0.994, -0.080 ], "z_axis": [ -0.564, -0.109, -0.818 ], "quaternion": [ -0.297, -0.024, 0.953, -0.050 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -68.890, "beta": 166.208, "gamma": 51.646, "delta": 80.521, "epsilon": -168.316, "zeta": -83.300, "epsilon_zeta": -85.016, "bb_type": "BI", "chi": -132.085, "glyco_bond": "anti", "C5prime_xyz": [ -3.170, 8.718, -1.518 ], "P_xyz": [ -1.373, 10.555, -2.161 ], "form": "B", "ssZp": 2.958, "Dp": 3.632, "splay_angle": 18.055, "splay_distance": 3.126, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 161.762, "theta": -170.507, "eta_prime": -175.577, "theta_prime": -172.684, "eta_base": 175.549, "theta_base": -148.163, "v0": -33.041, "v1": 9.863, "v2": 14.638, "v3": -34.635, "v4": 42.999, "amplitude": 41.811, "phase_angle": 69.507, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ -1.232, 2.395, 0.616 ], "x_axis": [ 0.521, -0.762, -0.384 ], "y_axis": [ 0.627, 0.647, -0.434 ], "z_axis": [ 0.579, -0.015, 0.815 ], "quaternion": [ 0.864, -0.121, 0.279, -0.402 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -82.823, "beta": 174.891, "gamma": 51.210, "delta": 81.460, "epsilon": -169.164, "zeta": -81.620, "epsilon_zeta": -87.544, "bb_type": "BI", "chi": -130.585, "glyco_bond": "anti", "C5prime_xyz": [ -1.881, 8.785, -1.016 ], "P_xyz": [ 0.511, 9.615, -1.797 ], "form": ".", "ssZp": 3.587, "Dp": 4.412, "splay_angle": 23.982, "splay_distance": 4.001, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 153.428, "theta": -169.375, "eta_prime": 159.555, "theta_prime": -162.223, "eta_base": -167.452, "theta_base": -173.249, "v0": -3.184, "v1": -19.711, "v2": 32.484, "v3": -35.703, "v4": 25.096, "amplitude": 35.527, "phase_angle": 23.885, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.565, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 0.421, 2.234, 3.264 ], "x_axis": [ 0.617, -0.353, -0.704 ], "y_axis": [ 0.429, 0.900, -0.075 ], "z_axis": [ 0.660, -0.256, 0.707 ], "quaternion": [ 0.898, 0.050, 0.380, -0.218 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -63.626, "beta": 175.651, "gamma": 65.506, "delta": 144.142, "epsilon": -178.465, "zeta": -89.245, "epsilon_zeta": -89.220, "bb_type": "BI", "chi": -106.237, "glyco_bond": "anti", "C5prime_xyz": [ -2.470, 8.274, -1.846 ], "P_xyz": [ -0.042, 9.305, -1.960 ], "form": ".", "ssZp": 2.062, "Dp": 2.217, "splay_angle": 39.464, "splay_distance": 6.957, "splay_ratio": 0.346, "d22": 4.399, "d64": 5.691, "eta": 169.331, "theta": -118.941, "eta_prime": -157.586, "theta_prime": -143.755, "eta_base": -168.367, "theta_base": -111.555, "v0": -23.017, "v1": 38.224, "v2": -37.384, "v3": 25.752, "v4": -1.986, "amplitude": 38.936, "phase_angle": 163.765, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.602, "filter_rmsd": 0.095, "frame": { "rmsd": 0.031, "origin": [ 1.727, 1.127, 6.880 ], "x_axis": [ 0.301, -0.143, -0.943 ], "y_axis": [ 0.540, 0.841, 0.045 ], "z_axis": [ 0.786, -0.522, 0.330 ], "quaternion": [ 0.786, 0.180, 0.550, -0.217 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/26", "linked_nts": [ "///A/25", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -66.036, "beta": -174.658, "gamma": 52.838, "delta": 131.403, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -144.328, "glyco_bond": "anti", "C5prime_xyz": [ -3.111, 8.858, -0.274 ], "P_xyz": [ -1.694, 10.681, 1.015 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -41.583, "v1": 47.806, "v2": -35.204, "v3": 12.323, "v4": 18.134, "amplitude": 46.863, "phase_angle": 138.696, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.093, "frame": { "rmsd": 0.032, "origin": [ 7.619, -2.444, 7.845 ], "x_axis": [ 0.384, 0.388, -0.838 ], "y_axis": [ -0.225, 0.920, 0.322 ], "z_axis": [ 0.896, 0.065, 0.440 ], "quaternion": [ 0.828, 0.078, 0.523, 0.185 ] } } ], "num_hbonds": 40, "hbonds": [ { "index": 1, "atom1_serNum": 32, "atom2_serNum": 437, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/2/OP1", "atom2_id": "///A/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 34, "atom2_serNum": 437, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/2/O5'", "atom2_id": "///A/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 37, "atom2_serNum": 437, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/2/O4'", "atom2_id": "///A/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 45, "atom2_serNum": 406, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/2/N3", "atom2_id": "///A/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 79, "atom2_serNum": 466, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/3/N6", "atom2_id": "///A/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 80, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/3/N1", "atom2_id": "///A/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 97, "atom2_serNum": 114, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/4/OP2", "atom2_id": "///A/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 108, "atom2_serNum": 375, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/4/N7", "atom2_id": "///A/12/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 108, "atom2_serNum": 405, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/4/N7", "atom2_id": "///A/13/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 111, "atom2_serNum": 373, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/4/O6", "atom2_id": "///A/12/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 112, "atom2_serNum": 696, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/4/N1", "atom2_id": "///A/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 114, "atom2_serNum": 693, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/4/N2", "atom2_id": "///A/22/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 141, "atom2_serNum": 732, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/5/N7", "atom2_id": "///A/23/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 144, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/5/O6", "atom2_id": "///A/23/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 145, "atom2_serNum": 339, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/5/N1", "atom2_id": "///A/11/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 147, "atom2_serNum": 336, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/5/N2", "atom2_id": "///A/11/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 174, "atom2_serNum": 765, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/6/N7", "atom2_id": "///A/24/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 177, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/6/O6", "atom2_id": "///A/24/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 177, "atom2_serNum": 765, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/6/O6", "atom2_id": "///A/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 178, "atom2_serNum": 306, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/6/N1", "atom2_id": "///A/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 180, "atom2_serNum": 303, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/6/N2", "atom2_id": "///A/10/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 211, "atom2_serNum": 793, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/7/N1", "atom2_id": "///A/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 239, "atom2_serNum": 793, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/8/O2", "atom2_id": "///A/25/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 240, "atom2_serNum": 792, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/8/N3", "atom2_id": "///A/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 260, "atom2_serNum": 825, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/9/OP2", "atom2_id": "///A/26/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 307, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/10/N1", "atom2_id": "///A/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 309, "atom2_serNum": 564, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/10/N2", "atom2_id": "///A/18/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 309, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/10/N2", "atom2_id": "///A/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 340, "atom2_serNum": 534, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/11/N1", "atom2_id": "///A/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 342, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/11/N2", "atom2_id": "///A/17/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 369, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/12/N7", "atom2_id": "///A/16/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 372, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/12/O6", "atom2_id": "///A/16/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 491, "atom2_serNum": 664, "donAcc_type": "questionable", "distance": 3.140, "atom1_id": "///A/16/O4'", "atom2_id": "///A/21/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 498, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/16/N7", "atom2_id": "///A/22/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 501, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/16/O6", "atom2_id": "///A/22/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 535, "atom2_serNum": 729, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/17/N1", "atom2_id": "///A/23/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 537, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/17/N2", "atom2_id": "///A/23/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 568, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/18/N1", "atom2_id": "///A/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 570, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/18/N2", "atom2_id": "///A/24/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 633, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/20/N1", "atom2_id": "///A/22/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9tnr", "num_naChains": 1, "naChains": "A=26", "num_atoms": 843, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }