**************************************************************************** File name: 9tnr.pdb no. of DNA/RNA chains: 1 [A=26] no. of nucleotides: 26 no. of atoms: 843 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 16 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.DA3 A.DT15 A+T rWC 21-XXI tWW tW+W 2 A.DG4 A.DG12 G+G -- 06-VI cHW cM+W 3 A.DG4 A.DG22 G+G -- 06-VI cWH cW+M 4 A.DG5 A.DG11 G+G -- 06-VI cWH cW+M 5 A.DG5 A.DG23 G+G -- 06-VI cHW cM+W 6 A.DG6 A.DG10 G+G -- 06-VI cWH cW+M 7 A.DG6 A.DG24 G+G -- 06-VI cHW cM+W 8 A.DA7 A.DT25 A+T rWC 21-XXI tWW tW+W 9 A.DT8 A.DT25 T+T -- 13-XIII tWW tW+W 10 A.DG10 A.DG18 G+G -- 06-VI cWH cW+M 11 A.DG11 A.DG17 G+G -- 06-VI cWH cW+M 12 A.DG12 A.DG16 G+G -- 06-VI cHW cM+W 13 A.DG16 A.DG22 G+G -- 06-VI cHW cM+W 14 A.DG17 A.DG23 G+G -- 06-VI cWH cW+M 15 A.DG18 A.DG24 G+G -- 06-VI cWH cW+M 16 A.DA20 A.DG22 A+G -- 10-X tWS tW+m **************************************************************************** List of 3 multiplets 1 nts=4 GGGG A.DG5,A.DG11,A.DG17,A.DG23 2 nts=4 GGGG A.DG6,A.DG10,A.DG18,A.DG24 3 nts=5 GGGAG A.DG4,A.DG12,A.DG16,A.DA20,A.DG22 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=4 strand-1 5'-GGGT-3' bp-type .... strand-2 5'-GGGT-3' helix-form ..x 1 A.DG4 A.DG22 G+G -- 06-VI cWH cW+M 2 A.DG5 A.DG23 G+G -- 06-VI cHW cM+W 3 A.DG6 A.DG24 G+G -- 06-VI cHW cM+W 4 A.DT8 A.DT25 T+T -- 13-XIII tWW tW+W -------------------------------------------------------------------------- helix#2[0] bps=4 strand-1 5'-GGGA-3' bp-type .... strand-2 3'-GGGT-5' helix-form ..x 1 A.DG10 A.DG18 G+G -- 06-VI cWH cW+M 2 A.DG11 A.DG17 G+G -- 06-VI cWH cW+M 3 A.DG12 A.DG16 G+G -- 06-VI cHW cM+W 4 A.DA3 A.DT15 A+T rWC 21-XXI tWW tW+W **************************************************************************** List of 5 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=3 TTT A.DT1,A.DT21,A.DT19 2 nts=4 TGGG A.DT9,A.DG18,A.DG17,A.DG16 3 nts=4 GGGT A.DG10,A.DG11,A.DG12,A.DT15 4 nts=5 GGGAT A.DG4,A.DG5,A.DG6,A.DA7,A.DT8 5 nts=8 ATAGGGTT A.DA14,A.DT2,A.DA3,A.DG22,A.DG23,A.DG24,A.DT25,A.DT26 **************************************************************************** Nucleotides not involved in stacking interactions nts=1 A A.DA13 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=26 TTAGGGATTGGGAATGGGTATGGGTT A.DT1,A.DT2,A.DA3,A.DG4,A.DG5,A.DG6,A.DA7,A.DT8,A.DT9,A.DG10,A.DG11,A.DG12,A.DA13,A.DA14,A.DT15,A.DG16,A.DG17,A.DG18,A.DT19,A.DA20,A.DT21,A.DG22,A.DG23,A.DG24,A.DT25,A.DT26 **************************************************************************** List of 3 G-tetrads 1 glyco-bond=s-ss sugar=---- groove=wn-- planarity=0.177 type=bowl-2 nts=4 GGGG A.DG4,A.DG12,A.DG16,A.DG22 2 glyco-bond=-s-- sugar=---3 groove=wn-- planarity=0.141 type=planar nts=4 GGGG A.DG5,A.DG11,A.DG17,A.DG23 3 glyco-bond=-s-- sugar=---3 groove=wn-- planarity=0.259 type=other nts=4 GGGG A.DG6,A.DG10,A.DG18,A.DG24 **************************************************************************** List of 1 G4-helix Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem. helix#1[1] stems=[#1] layers=3 INTRA-molecular 1 glyco-bond=s-ss sugar=---- groove=wn-- Major-->WC nts=4 GGGG A.DG4,A.DG12,A.DG16,A.DG22 2 glyco-bond=-s-- sugar=---3 groove=wn-- WC-->Major nts=4 GGGG A.DG5,A.DG11,A.DG17,A.DG23 3 glyco-bond=-s-- sugar=---3 groove=wn-- WC-->Major nts=4 GGGG A.DG6,A.DG10,A.DG18,A.DG24 step#1 mm(<>,outward) area=18.84 rise=3.43 twist=15.6 step#2 pm(>>,forward) area=12.75 rise=3.46 twist=26.5 strand#1 DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG4,A.DG5,A.DG6 strand#2 DNA glyco-bond=-ss sugar=--- nts=3 GGG A.DG12,A.DG11,A.DG10 strand#3 DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18 strand#4 DNA glyco-bond=s-- sugar=-33 nts=3 GGG A.DG22,A.DG23,A.DG24 **************************************************************************** List of 1 G4-stem Note: a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands. stem#1[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-Lw-Ln-P) note=3+1 UDUU hybrid3 1 glyco-bond=s-ss sugar=---- groove=wn-- Major-->WC nts=4 GGGG A.DG4,A.DG12,A.DG16,A.DG22 2 glyco-bond=-s-- sugar=---3 groove=wn-- WC-->Major nts=4 GGGG A.DG5,A.DG11,A.DG17,A.DG23 3 glyco-bond=-s-- sugar=---3 groove=wn-- WC-->Major nts=4 GGGG A.DG6,A.DG10,A.DG18,A.DG24 step#1 mm(<>,outward) area=18.84 rise=3.43 twist=15.6 step#2 pm(>>,forward) area=12.75 rise=3.46 twist=26.5 strand#1 U DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG4,A.DG5,A.DG6 strand#2 D DNA glyco-bond=-ss sugar=--- nts=3 GGG A.DG12,A.DG11,A.DG10 strand#3 U DNA glyco-bond=s-- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18 strand#4 U DNA glyco-bond=s-- sugar=-33 nts=3 GGG A.DG22,A.DG23,A.DG24 loop#1 type=lateral strands=[#1,#2] nts=3 ATT A.DA7,A.DT8,A.DT9 loop#2 type=lateral strands=[#2,#3] nts=3 AAT A.DA13,A.DA14,A.DT15 loop#3 type=propeller strands=[#3,#4] nts=3 TAT A.DT19,A.DA20,A.DT21 **************************************************************************** List of 1 splayed-apart dinucleotide 1 A.DT1 A.DT2 angle=89 distance=14.4 ratio=0.70 ---------------------------------------------------------------- Summary of 1 splayed-apart unit 1 nts=2 TT A.DT1,A.DT2 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >9tnr nts=26 [whole] TTAGGGATTGGGAATGGGTATGGGTT .......................... >9tnr-A #1 nts=26 0.05(2.16) [chain] DNA TTAGGGATTGGGAATGGGTATGGGTT .......................... **************************************************************************** Summary of structural features of 26 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . A.DT1 0.027 anti,non-pair-contact,ss-non-loop,splayed-apart 2 T . A.DT2 0.039 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 3 A . A.DA3 0.027 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 4 G . A.DG4 0.032 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,phosphate 5 G . A.DG5 0.024 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 6 G . A.DG6 0.029 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 7 A . A.DA7 0.034 anti,~C2'-endo,BI,non-canonical,non-pair-contact,ss-non-loop 8 T . A.DT8 0.028 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 9 T . A.DT9 0.033 turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate 10 G . A.DG10 0.025 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 11 G . A.DG11 0.024 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 12 G . A.DG12 0.028 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 13 A . A.DA13 0.031 anti,~C2'-endo,BI,non-stack,non-pair-contact,ss-non-loop 14 A . A.DA14 0.031 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 15 T . A.DT15 0.030 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 16 G . A.DG16 0.032 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 17 G . A.DG17 0.033 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 18 G . A.DG18 0.023 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 19 T . A.DT19 0.034 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 20 A . A.DA20 0.028 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop 21 T . A.DT21 0.039 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 22 G . A.DG22 0.026 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 23 G . A.DG23 0.028 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 24 G . A.DG24 0.031 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 25 T . A.DT25 0.031 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 26 T . A.DT26 0.032 anti,~C2'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia