{ "num_pairs": 17, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/13", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "intra_chain": true, "chi1": -108.931, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 40.369, "chi2": 143.209, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 89.937, "C1C1_dist": 7.514, "N1N9_dist": 6.408, "C6C8_dist": 4.386, "CNNC_torsion": 4.089, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N7[3.43]", "interBase_angle": 36.634, "planarity": 0.413, "simple_Shear": -3.303, "simple_Stretch": 7.495, "simple_Buckle": -31.212, "simple_Propeller": -19.181, "bp_simpleParams": [ -3.303, 7.495, -0.197, -31.212, -19.181, 123.487 ], "bp_params": [ -3.003, -7.620, -0.197, 35.525, -8.947, 121.264 ], "frame": { "rmsd": null, "origin": [ -0.638, 8.262, -3.479 ], "x_axis": [ -0.734, 0.053, -0.677 ], "y_axis": [ 0.676, -0.037, -0.736 ], "z_axis": [ -0.064, -0.998, -0.009 ], "quaternion": [ -0.235, -0.279, -0.653, 0.664 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/10", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -97.702, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 66.541, "chi2": 80.149, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 30.443, "C1C1_dist": 11.277, "N1N9_dist": 9.451, "C6C8_dist": 9.135, "CNNC_torsion": -8.832, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.80],N2(amino)-N7[2.81]", "interBase_angle": 1.760, "planarity": 0.145, "simple_Shear": -2.501, "simple_Stretch": 2.694, "simple_Buckle": -1.609, "simple_Propeller": 0.715, "bp_simpleParams": [ -2.501, 2.694, 0.631, -1.609, 0.715, -88.157 ], "bp_params": [ 1.609, 3.305, 0.631, 0.086, 1.758, -88.164 ], "frame": { "rmsd": null, "origin": [ -1.549, 4.854, -2.559 ], "x_axis": [ 0.883, -0.283, 0.375 ], "y_axis": [ -0.314, 0.239, 0.919 ], "z_axis": [ -0.349, -0.929, 0.122 ], "quaternion": [ 0.749, 0.617, -0.242, 0.010 ] } }, { "index": 3, "nt1": "///A/2", "nt2": "///A/14", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -97.702, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 29.539, "chi2": -111.741, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 70.395, "C1C1_dist": 11.306, "N1N9_dist": 9.544, "C6C8_dist": 9.321, "CNNC_torsion": 18.122, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.84],O6(carbonyl)-N1(imino)[2.84]", "interBase_angle": 26.360, "planarity": 0.360, "simple_Shear": -2.367, "simple_Stretch": 2.982, "simple_Buckle": -17.156, "simple_Propeller": -20.014, "bp_simpleParams": [ -2.367, 2.982, -0.484, -17.156, -20.014, 86.741 ], "bp_params": [ -1.993, -3.244, -0.484, 24.687, -9.244, 85.591 ], "frame": { "rmsd": null, "origin": [ 0.373, 4.239, -0.933 ], "x_axis": [ 0.380, -0.175, -0.908 ], "y_axis": [ 0.918, -0.048, 0.394 ], "z_axis": [ -0.112, -0.983, 0.142 ], "quaternion": [ 0.607, 0.567, 0.328, -0.450 ] } }, { "index": 4, "nt1": "///A/3", "nt2": "///A/9", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 42.951, "conf1": "syn", "pucker1": "pucker-CHK", "lambda1": 30.157, "chi2": -101.313, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 65.069, "C1C1_dist": 11.521, "N1N9_dist": 9.639, "C6C8_dist": 9.341, "CNNC_torsion": -23.507, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.90],O6(carbonyl)-N1(imino)[2.79]", "interBase_angle": 14.391, "planarity": 0.201, "simple_Shear": -2.450, "simple_Stretch": 2.730, "simple_Buckle": 13.456, "simple_Propeller": 5.100, "bp_simpleParams": [ -2.450, 2.730, -0.220, 13.456, 5.100, 90.898 ], "bp_params": [ -1.736, -3.231, -0.220, -9.351, 10.938, 90.968 ], "frame": { "rmsd": null, "origin": [ -1.415, 1.180, -1.067 ], "x_axis": [ 0.639, -0.206, -0.741 ], "y_axis": [ -0.737, 0.111, -0.667 ], "z_axis": [ 0.220, 0.972, -0.081 ], "quaternion": [ 0.646, -0.634, 0.372, 0.205 ] } }, { "index": 5, "nt1": "///A/3", "nt2": "///A/15", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 42.951, "conf1": "syn", "pucker1": "pucker-CHK", "lambda1": 60.328, "chi2": 78.454, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 26.055, "C1C1_dist": 11.788, "N1N9_dist": 9.757, "C6C8_dist": 9.454, "CNNC_torsion": -8.078, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.79],N2(amino)-N7[2.97]", "interBase_angle": 11.454, "planarity": 0.159, "simple_Shear": -2.482, "simple_Stretch": 2.706, "simple_Buckle": 6.466, "simple_Propeller": 9.455, "bp_simpleParams": [ -2.482, 2.706, -0.081, 6.466, 9.455, -93.014 ], "bp_params": [ 1.697, 3.257, -0.081, 11.096, -2.845, -92.763 ], "frame": { "rmsd": null, "origin": [ 0.858, 0.766, -0.059 ], "x_axis": [ -0.779, 0.018, -0.627 ], "y_axis": [ -0.611, 0.203, 0.765 ], "z_axis": [ 0.141, 0.979, -0.147 ], "quaternion": [ 0.263, -0.203, 0.730, 0.598 ] } }, { "index": 6, "nt1": "///A/4", "nt2": "///A/8", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -112.743, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 69.203, "chi2": 58.716, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 36.778, "C1C1_dist": 10.842, "N1N9_dist": 9.154, "C6C8_dist": 8.846, "CNNC_torsion": -3.174, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.84],N2(amino)-N7[2.79]", "interBase_angle": 25.138, "planarity": 0.391, "simple_Shear": -2.361, "simple_Stretch": 2.977, "simple_Buckle": 3.162, "simple_Propeller": 24.938, "bp_simpleParams": [ -2.361, 2.977, 0.148, 3.162, 24.938, -78.600 ], "bp_params": [ 1.834, 3.327, 0.148, 24.212, 6.758, -77.438 ], "frame": { "rmsd": null, "origin": [ -0.398, -2.066, -3.770 ], "x_axis": [ 0.362, 0.175, 0.916 ], "y_axis": [ -0.931, 0.023, 0.364 ], "z_axis": [ 0.043, -0.984, 0.171 ], "quaternion": [ 0.624, 0.540, -0.350, 0.443 ] } }, { "index": 7, "nt1": "///A/4", "nt2": "///A/15", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "intra_chain": true, "chi1": -112.743, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 19.854, "chi2": 78.454, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 20.882, "C1C1_dist": 12.847, "N1N9_dist": 10.093, "C6C8_dist": 7.965, "CNNC_torsion": 54.591, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)*O6(carbonyl)[3.09]", "interBase_angle": 18.853, "planarity": 0.378, "simple_Shear": -0.384, "simple_Stretch": 4.676, "simple_Buckle": 18.700, "simple_Propeller": -2.404, "bp_simpleParams": [ -0.384, 4.676, 1.780, 18.700, -2.404, -143.062 ], "bp_params": [ -0.962, 4.592, 1.780, 18.853, -0.039, -142.591 ], "frame": { "rmsd": null, "origin": [ 0.454, -0.740, -1.546 ], "x_axis": [ -0.187, 0.098, 0.978 ], "y_axis": [ -0.977, -0.119, -0.175 ], "z_axis": [ 0.099, -0.988, 0.118 ], "quaternion": [ 0.451, 0.451, -0.487, 0.597 ] } }, { "index": 8, "nt1": "///A/4", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -112.743, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 31.251, "chi2": -99.354, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.708, "C1C1_dist": 11.295, "N1N9_dist": 9.417, "C6C8_dist": 9.161, "CNNC_torsion": -42.898, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.88],O6(carbonyl)-N1(imino)[2.88]", "interBase_angle": 27.256, "planarity": 0.383, "simple_Shear": -2.560, "simple_Stretch": 2.523, "simple_Buckle": 26.743, "simple_Propeller": 5.260, "bp_simpleParams": [ -2.560, 2.523, -0.704, 26.743, 5.260, 91.580 ], "bp_params": [ -1.458, -3.286, -0.704, -14.276, 23.218, 92.317 ], "frame": { "rmsd": null, "origin": [ -0.428, -2.134, -0.929 ], "x_axis": [ 0.957, 0.004, -0.291 ], "y_axis": [ 0.290, 0.093, 0.953 ], "z_axis": [ 0.031, -0.996, 0.088 ], "quaternion": [ 0.731, 0.666, 0.110, -0.098 ] } }, { "index": 9, "nt1": "///A/6", "nt2": "///A/16", "bp": "T+G", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -166.267, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 5.505, "chi2": -99.354, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.282, "C1C1_dist": 12.282, "N1N9_dist": 9.853, "C6C8_dist": 9.903, "CNNC_torsion": -155.473, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[2.89],O4(carbonyl)-N2(amino)[3.15]", "interBase_angle": 34.590, "planarity": 0.685, "simple_Shear": -1.539, "simple_Stretch": 0.904, "simple_Buckle": 33.349, "simple_Propeller": -9.181, "bp_simpleParams": [ -1.539, 0.904, 1.485, 33.349, -9.181, 138.081 ], "bp_params": [ -0.626, -1.672, 1.485, 3.060, 34.454, 139.794 ], "frame": { "rmsd": null, "origin": [ 0.627, -3.121, -0.384 ], "x_axis": [ 0.987, 0.107, 0.121 ], "y_axis": [ -0.124, 0.025, 0.992 ], "z_axis": [ 0.103, -0.994, 0.038 ], "quaternion": [ 0.716, 0.694, -0.006, 0.081 ] } }, { "index": 10, "nt1": "///A/6", "nt2": "///A/19", "bp": "T-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.267, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 37.510, "chi2": -75.573, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.840, "C1C1_dist": 11.268, "N1N9_dist": 9.154, "C6C8_dist": 9.250, "CNNC_torsion": 34.739, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.24],O4(carbonyl)-N6(amino)[2.49]", "interBase_angle": 36.117, "planarity": 0.477, "simple_Shear": -1.764, "simple_Stretch": 0.301, "simple_Buckle": 35.927, "simple_Propeller": -3.697, "bp_simpleParams": [ -1.764, 0.301, -1.632, 35.927, -3.697, -39.208 ], "bp_params": [ -1.789, -0.043, -1.632, 35.959, 3.373, -37.446 ], "frame": { "rmsd": null, "origin": [ 0.476, -4.745, -0.343 ], "x_axis": [ -0.088, -0.020, 0.996 ], "y_axis": [ -0.992, -0.094, -0.090 ], "z_axis": [ 0.095, -0.995, -0.011 ], "quaternion": [ 0.449, 0.504, -0.502, 0.541 ] } }, { "index": 11, "nt1": "///A/7", "nt2": "///A/18", "bp": "A-T", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -97.387, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 8.206, "chi2": -123.296, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 41.309, "C1C1_dist": 9.541, "N1N9_dist": 7.066, "C6C8_dist": 6.626, "CNNC_torsion": -174.994, "hbonds_num": 2, "hbonds_desc": "N7-N3(imino)[2.94],N6(amino)-O2(carbonyl)[2.42]", "interBase_angle": 65.177, "planarity": 0.774, "simple_Shear": -4.652, "simple_Stretch": 0.114, "simple_Buckle": -33.868, "simple_Propeller": -55.687, "bp_simpleParams": [ -4.652, 0.114, -1.665, -33.868, -55.687, -67.383 ], "bp_params": [ -3.728, -2.784, -1.665, 9.429, -64.491, -76.327 ], "frame": { "rmsd": null, "origin": [ 2.169, -8.540, -2.725 ], "x_axis": [ -0.689, -0.267, 0.674 ], "y_axis": [ -0.724, 0.269, -0.635 ], "z_axis": [ -0.012, -0.925, -0.379 ], "quaternion": [ -0.224, -0.324, 0.764, -0.510 ] } }, { "index": 12, "nt1": "///A/8", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 58.716, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 55.343, "chi2": 69.837, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 26.726, "C1C1_dist": 11.565, "N1N9_dist": 9.441, "C6C8_dist": 9.004, "CNNC_torsion": -3.234, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.79],N2(amino)-N7[2.94]", "interBase_angle": 15.849, "planarity": 0.219, "simple_Shear": -2.880, "simple_Stretch": 2.270, "simple_Buckle": 1.569, "simple_Propeller": 15.771, "bp_simpleParams": [ -2.880, 2.270, -0.193, 1.569, 15.771, -95.460 ], "bp_params": [ 0.957, 3.540, -0.193, 15.119, 4.757, -95.011 ], "frame": { "rmsd": null, "origin": [ 1.925, -2.427, -3.783 ], "x_axis": [ -0.899, 0.196, 0.391 ], "y_axis": [ -0.394, 0.027, -0.919 ], "z_axis": [ -0.191, -0.980, 0.053 ], "quaternion": [ 0.213, 0.072, -0.684, 0.694 ] } }, { "index": 13, "nt1": "///A/9", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -101.313, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 28.292, "chi2": -116.328, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 65.966, "C1C1_dist": 11.391, "N1N9_dist": 9.503, "C6C8_dist": 9.136, "CNNC_torsion": -3.059, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.83],O6(carbonyl)-N1(imino)[2.86]", "interBase_angle": 12.123, "planarity": 0.169, "simple_Shear": -2.576, "simple_Stretch": 2.834, "simple_Buckle": 2.864, "simple_Propeller": 11.780, "bp_simpleParams": [ -2.576, 2.834, 0.127, 2.864, 11.780, 87.088 ], "bp_params": [ -1.654, -3.454, 0.127, -11.990, -1.793, 86.781 ], "frame": { "rmsd": null, "origin": [ -0.284, 1.042, -3.554 ], "x_axis": [ 0.729, -0.208, 0.652 ], "y_axis": [ 0.666, -0.007, -0.746 ], "z_axis": [ 0.160, 0.978, 0.134 ], "quaternion": [ 0.681, -0.633, -0.181, -0.321 ] } }, { "index": 14, "nt1": "///A/10", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 80.149, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 61.319, "chi2": 67.482, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 27.845, "C1C1_dist": 11.431, "N1N9_dist": 9.449, "C6C8_dist": 9.130, "CNNC_torsion": 22.991, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.78],N2(amino)-N7[2.87]", "interBase_angle": 23.748, "planarity": 0.319, "simple_Shear": -2.481, "simple_Stretch": 2.708, "simple_Buckle": -23.738, "simple_Propeller": -0.695, "bp_simpleParams": [ -2.481, 2.708, 0.002, -23.738, -0.695, -89.360 ], "bp_params": [ 1.666, 3.273, 0.002, -8.966, 21.990, -90.246 ], "frame": { "rmsd": null, "origin": [ 0.150, 4.568, -4.604 ], "x_axis": [ -0.359, 0.053, 0.932 ], "y_axis": [ -0.905, 0.226, -0.361 ], "z_axis": [ -0.229, -0.973, -0.033 ], "quaternion": [ -0.457, -0.335, 0.636, -0.524 ] } }, { "index": 15, "nt1": "///A/14", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -111.741, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 27.552, "chi2": 67.482, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 63.063, "C1C1_dist": 11.525, "N1N9_dist": 9.576, "C6C8_dist": 9.306, "CNNC_torsion": 42.309, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.89],O6(carbonyl)-N1(imino)[2.82]", "interBase_angle": 22.451, "planarity": 0.309, "simple_Shear": -2.457, "simple_Stretch": 2.687, "simple_Buckle": -21.631, "simple_Propeller": -6.011, "bp_simpleParams": [ -2.457, 2.687, 0.351, -21.631, -6.011, 90.923 ], "bp_params": [ -1.698, -3.221, 0.351, 12.915, -18.364, 91.297 ], "frame": { "rmsd": null, "origin": [ 2.072, 3.953, -2.977 ], "x_axis": [ -0.918, -0.008, -0.398 ], "y_axis": [ 0.397, 0.021, -0.917 ], "z_axis": [ 0.016, -1.000, -0.016 ], "quaternion": [ 0.148, 0.139, 0.699, -0.685 ] } }, { "index": 16, "nt1": "///A/15", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 78.454, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 66.274, "chi2": -116.328, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.334, "C1C1_dist": 11.486, "N1N9_dist": 9.602, "C6C8_dist": 9.380, "CNNC_torsion": -23.239, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.79],N2(amino)-N7[2.83]", "interBase_angle": 17.968, "planarity": 0.245, "simple_Shear": -2.237, "simple_Stretch": 2.952, "simple_Buckle": 15.909, "simple_Propeller": 8.351, "bp_simpleParams": [ -2.237, 2.952, -0.009, 15.909, 8.351, -87.125 ], "bp_params": [ 2.077, 3.067, -0.009, 12.994, -12.410, -87.093 ], "frame": { "rmsd": null, "origin": [ 1.989, 0.628, -2.545 ], "x_axis": [ -0.630, -0.000, 0.777 ], "y_axis": [ 0.773, -0.106, 0.626 ], "z_axis": [ 0.082, 0.994, 0.067 ], "quaternion": [ -0.288, 0.320, 0.603, 0.671 ] } }, { "index": 17, "nt1": "///A/16", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -99.354, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 21.631, "chi2": 69.837, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 63.777, "C1C1_dist": 11.818, "N1N9_dist": 9.835, "C6C8_dist": 9.587, "CNNC_torsion": 14.285, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.01],O6(carbonyl)-N1(imino)[2.76]", "interBase_angle": 6.345, "planarity": 0.088, "simple_Shear": -2.313, "simple_Stretch": 2.784, "simple_Buckle": -6.334, "simple_Propeller": 0.376, "bp_simpleParams": [ -2.313, 2.784, 0.049, -6.334, 0.376, 93.063 ], "bp_params": [ -1.898, -3.082, 0.049, 1.672, -6.121, 93.138 ], "frame": { "rmsd": null, "origin": [ 1.895, -2.496, -0.942 ], "x_axis": [ -0.313, 0.092, -0.945 ], "y_axis": [ 0.928, -0.181, -0.325 ], "z_axis": [ -0.201, -0.979, -0.029 ], "quaternion": [ -0.345, -0.473, -0.539, 0.605 ] } } ], "num_multiplets": 3, "multiplets": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/2,///A/10,///A/14,///A/22", "planarity": 0.412 }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/3,///A/9,///A/15,///A/21", "planarity": 0.275 }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/4,///A/8,///A/16,///A/20", "planarity": 0.341 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 0, "strand1": "AGGGTA", "strand2": "AGGGAT", "bp_type": "....|.", "helix_form": "...x.", "helical_rise": 3.346, "helical_rise_std": 0.885, "helical_radius": 8.309, "helical_radius_std": 1.727, "helical_axis": [ 0.099, -0.995, 0.004 ], "point1": [ 0.221, 7.491, 0.024 ], "point2": [ 1.887, -9.181, 0.088 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/13", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "bp1_params": [ -3.003, -7.620, -0.197, 35.525, -8.947, 121.264 ], "step_params": [ -2.512, 0.858, 4.079, 4.578, -7.916, 70.606 ], "heli_params": [ 1.068, 2.351, 3.830, -6.820, -3.944, 71.120 ], "bp2_params": [ -1.993, -3.244, -0.484, 24.687, -9.244, 85.591 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.079, "simple_Twist": 39.769, "simple_hRise": 3.553, "simple_hTwist": 40.765 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/14", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.993, -3.244, -0.484, 24.687, -9.244, 85.591 ], "step_params": [ 0.811, 0.583, 3.473, 0.121, -1.710, 105.639 ], "heli_params": [ 0.390, -0.507, 3.467, -1.073, -0.076, 105.649 ], "bp2_params": [ 1.697, 3.257, -0.081, 11.096, -2.845, -92.763 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.473, "simple_Twist": 34.762, "simple_hRise": 3.444, "simple_hTwist": 34.803 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/15", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.697, 3.257, -0.081, 11.096, -2.845, -92.763 ], "step_params": [ -1.335, -0.976, 2.844, 5.269, 9.091, -55.135 ], "heli_params": [ 0.565, -1.147, 3.063, -9.723, 5.635, -56.050 ], "bp2_params": [ -1.458, -3.286, -0.704, -14.276, 23.218, 92.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.844, "simple_Twist": 17.451, "simple_hRise": 1.667, "simple_hTwist": 20.350 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.458, -3.286, -0.704, -14.276, 23.218, 92.317 ], "step_params": [ 0.877, -0.089, 2.683, 6.718, -0.760, 112.278 ], "heli_params": [ -0.046, -0.464, 2.715, -0.457, -4.043, 112.411 ], "bp2_params": [ -1.789, -0.043, -1.632, 35.959, 3.373, -37.446 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.683, "simple_Twist": -6.329, "simple_hRise": 1.192, "simple_hTwist": -9.258 }, { "index": 5, "nt1": "///A/6", "nt2": "///A/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.789, -0.043, -1.632, 35.959, 3.373, -37.446 ], "step_params": [ -2.059, -0.740, 4.262, -14.430, -17.178, 39.405 ], "heli_params": [ 1.294, 0.786, 4.647, -23.328, 19.595, 45.122 ], "bp2_params": [ -3.728, -2.784, -1.665, 9.429, -64.491, -76.327 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.262, "simple_Twist": 55.666, "simple_hRise": 4.653, "simple_hTwist": 59.680 }, { "index": 6, "nt1": "///A/7", "nt2": "///A/18", "bp": "A-T", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W" } ] }, { "index": 2, "num_stems": 0, "strand1": "GGG", "strand2": "GGG", "bp_type": "...", "helix_form": "..", "helical_rise": 3.688, "helical_rise_std": 0.166, "helical_radius": 11.540, "helical_radius_std": 1.099, "helical_axis": [ 0.227, 0.962, -0.151 ], "point1": [ -0.360, -1.123, -0.728 ], "point2": [ 1.357, 6.153, -1.873 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/8", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 0.957, 3.540, -0.193, 15.119, 4.757, -95.011 ], "step_params": [ -2.734, -0.542, 3.032, 10.882, -0.030, -64.123 ], "heli_params": [ 0.506, -2.095, 3.407, 0.028, 10.172, -64.943 ], "bp2_params": [ -1.654, -3.454, 0.127, -11.990, -1.793, 86.781 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.032, "simple_Twist": 11.870, "simple_hRise": 0.399, "simple_hTwist": 16.090 }, { "index": 2, "nt1": "///A/9", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.654, -3.454, 0.127, -11.990, -1.793, 86.781 ], "step_params": [ 0.065, 1.367, 3.443, -4.648, 5.237, 109.649 ], "heli_params": [ 0.767, -0.100, 3.481, 3.201, 2.841, 109.800 ], "bp2_params": [ 1.666, 3.273, 0.002, -8.966, 21.990, -90.246 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.443, "simple_Twist": 36.327, "simple_hRise": 3.564, "simple_hTwist": 36.973 }, { "index": 3, "nt1": "///A/10", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M" } ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/8,///A/9,///A/10" }, { "index": 2, "num_nts": 4, "nts_short": "AGGG", "nts_long": "///A/13,///A/22,///A/21,///A/20" }, { "index": 3, "num_nts": 5, "nts_short": "GGGAT", "nts_long": "///A/14,///A/15,///A/16,///A/19,///A/18" }, { "index": 4, "num_nts": 6, "nts_short": "TGGGAT", "nts_long": "///A/6,///A/4,///A/3,///A/2,///A/1,///A/12" } ], "nonStack": { "num_nts": 4, "nts_short": "TATT", "nts_long": "///A/5,///A/7,///A/11,///A/17" }, "num_ssSegments": 1, "ssSegments": [ { "index": 1, "num_nts": 22, "nts_short": "AGGGTTAGGGTTAGGGTTAGGG", "nts_long": "///A/1,///A/2,///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22" } ], "num_Gtetrads": 3, "Gtetrads": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/2,///A/10,///A/22,///A/14", "planarity": 0.412, "G1G2_simpleParams": [ -2.501, 2.694, 0.631, -1.609, 0.715, -88.157 ], "G2G3_simpleParams": [ -2.481, 2.708, 0.002, -23.738, -0.695, -89.360 ], "G3G4_simpleParams": [ -2.457, 2.687, -0.351, -21.631, -6.011, -90.923 ], "G4G1_simpleParams": [ -2.367, 2.982, 0.484, -17.156, -20.014, -86.741 ], "type": "other", "direction": "WC-->Major", "ONZ_class": "N+", "glyco_bond": "-ss-", "sugar_pucker": "----", "groove_type": "w-n-", "groove_distPP": [ 19.847, 14.807, 9.498, 12.730 ], "rmsd": 0.294, "frame": { "rmsd": null, "origin": [ 0.340, 5.001, -2.733 ], "x_axis": [ 0.833, -0.175, -0.525 ], "y_axis": [ 0.526, -0.045, 0.849 ], "z_axis": [ -0.172, -0.984, 0.055 ], "quaternion": [ 0.679, 0.675, 0.130, -0.258 ] } }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/3,///A/9,///A/21,///A/15", "planarity": 0.275, "G1G2_simpleParams": [ -2.450, 2.730, -0.220, 13.456, 5.100, 90.898 ], "G2G3_simpleParams": [ -2.576, 2.834, 0.127, 2.864, 11.780, 87.088 ], "G3G4_simpleParams": [ -2.237, 2.952, 0.009, 15.909, 8.351, 87.125 ], "G4G1_simpleParams": [ -2.482, 2.706, 0.081, 6.466, 9.455, 93.014 ], "type": "bowl", "direction": "Major-->WC", "ONZ_class": "N-", "glyco_bond": "s--s", "sugar_pucker": ".---", "groove_type": "w-n-", "groove_distPP": [ 21.673, 17.198, 11.698, 15.928 ], "rmsd": 0.252, "frame": { "rmsd": null, "origin": [ 0.391, 1.267, -1.855 ], "x_axis": [ -0.985, 0.151, -0.085 ], "y_axis": [ -0.083, 0.020, 0.996 ], "z_axis": [ 0.152, 0.988, -0.007 ], "quaternion": [ 0.083, 0.024, 0.709, 0.700 ] } }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/4,///A/8,///A/20,///A/16", "planarity": 0.341, "G1G2_simpleParams": [ -2.361, 2.977, 0.148, 3.162, 24.938, -78.600 ], "G2G3_simpleParams": [ -2.880, 2.270, -0.193, 1.569, 15.771, -95.460 ], "G3G4_simpleParams": [ -2.313, 2.784, -0.049, -6.334, 0.376, -93.063 ], "G4G1_simpleParams": [ -2.560, 2.523, 0.704, 26.743, 5.260, -91.580 ], "type": "other", "direction": "WC-->Major", "ONZ_class": "N+", "glyco_bond": "-ss-", "sugar_pucker": "----", "groove_type": "w-n-", "groove_distPP": [ 17.385, 13.782, 8.721, 14.036 ], "rmsd": 0.389, "frame": { "rmsd": null, "origin": [ 0.628, -2.521, -2.310 ], "x_axis": [ 0.958, -0.058, 0.282 ], "y_axis": [ -0.276, 0.091, 0.957 ], "z_axis": [ -0.081, -0.994, 0.071 ], "quaternion": [ 0.728, 0.670, -0.125, 0.075 ] } } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "GT", "nts_long": "///A/10,///A/11" }, { "index": 2, "num_nts": 2, "nts_short": "TA", "nts_long": "///A/12,///A/13" } ], "dbn": { "all_chains": { "num_nts": 22, "num_chars": 22, "bseq": "AGGGTTAGGGTTAGGGTTAGGG", "sstr": "......................", "form": "......Z..............-" }, "m1_chain_A": { "num_nts": 22, "num_chars": 22, "bseq": "AGGGTTAGGGTTAGGGTTAGGG", "sstr": "......................", "form": "......Z..............-" } }, "chains": { "m1_chain_A": { "num_nts": 22, "bseq": "AGGGTTAGGGTTAGGGTTAGGG", "sstr": "......................", "form": "......Z..............-", "helical_rise": 0.475, "helical_rise_std": 2.726, "helical_axis": [ -0.683, -0.343, -0.645 ], "point1": [ 2.831, 3.006, 6.520 ], "point2": [ -4.512, -0.677, -0.404 ], "num_chars": 64, "suite": "A!!G!!G!!G!!T!!T!!A!!G!!G!!G!!T4bT2[A!!G!!G!!G2zT!!T!!A!!G!!G!!G" } }, "num_nts": 22, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": null, "beta": null, "gamma": -57.489, "delta": 143.491, "epsilon": 179.941, "zeta": -99.185, "epsilon_zeta": -80.875, "bb_type": "BI", "chi": -108.931, "glyco_bond": "anti", "C5prime_xyz": [ -2.645, 8.432, -1.650 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.336, "Dp": 2.371, "splay_angle": 23.735, "splay_distance": 3.889, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.826, "v1": 43.011, "v2": -42.221, "v3": 27.399, "v4": -0.564, "amplitude": 44.359, "phase_angle": 162.138, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ -2.107, 8.420, 0.342 ], "x_axis": [ 0.187, -0.307, -0.933 ], "y_axis": [ 0.960, -0.146, 0.240 ], "z_axis": [ -0.210, -0.940, 0.268 ], "quaternion": [ 0.572, 0.516, 0.316, -0.554 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -63.726, "beta": -173.968, "gamma": 56.832, "delta": 148.137, "epsilon": -164.457, "zeta": -92.839, "epsilon_zeta": -71.618, "bb_type": "BI", "chi": -97.702, "glyco_bond": "anti", "C5prime_xyz": [ -2.530, 7.957, -2.372 ], "P_xyz": [ -0.269, 9.347, -2.417 ], "form": ".", "ssZp": 1.574, "Dp": 1.743, "splay_angle": 24.181, "splay_distance": 3.958, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 175.925, "theta": -108.019, "eta_prime": -150.264, "theta_prime": -164.397, "eta_base": -82.836, "theta_base": -90.679, "v0": -26.428, "v1": 43.382, "v2": -42.700, "v3": 29.087, "v4": -1.855, "amplitude": 44.528, "phase_angle": 163.524, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -1.468, 4.728, -0.700 ], "x_axis": [ 0.857, -0.358, -0.371 ], "y_axis": [ 0.392, -0.016, 0.920 ], "z_axis": [ -0.335, -0.933, 0.127 ], "quaternion": [ 0.701, 0.661, 0.013, -0.267 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -51.377, "beta": 143.842, "gamma": 71.658, "delta": 178.028, "epsilon": 155.778, "zeta": 122.638, "epsilon_zeta": 33.140, "bb_type": "--", "chi": 42.951, "glyco_bond": "syn", "C5prime_xyz": [ -5.478, 5.142, 1.010 ], "P_xyz": [ -7.996, 4.640, 1.656 ], "form": ".", "ssZp": -3.706, "Dp": 4.247, "splay_angle": 30.424, "splay_distance": 4.310, "splay_ratio": 0.288, "d22": null, "d64": null, "eta": 137.166, "theta": 135.077, "eta_prime": 108.091, "theta_prime": -178.011, "eta_base": -136.721, "theta_base": 166.476, "v0": 38.227, "v1": -43.584, "v2": 29.593, "v3": -6.847, "v4": -20.112, "amplitude": 42.779, "phase_angle": 313.769, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "is_L_sugar": true, "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ -0.803, 1.072, 0.662 ], "x_axis": [ -0.105, -0.186, -0.977 ], "y_axis": [ -0.970, 0.235, 0.059 ], "z_axis": [ 0.219, 0.954, -0.205 ], "quaternion": [ 0.481, -0.465, 0.621, 0.408 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -74.333, "beta": 168.939, "gamma": 66.023, "delta": 157.688, "epsilon": -152.202, "zeta": -76.434, "epsilon_zeta": -75.768, "bb_type": "BI", "chi": -112.743, "glyco_bond": "anti", "C5prime_xyz": [ -1.834, 8.361, -1.208 ], "P_xyz": [ 0.894, 8.314, -0.848 ], "form": ".", "ssZp": 2.030, "Dp": 1.921, "splay_angle": 77.120, "splay_distance": 12.717, "splay_ratio": 0.625, "d22": null, "d64": null, "eta": -179.257, "theta": -37.334, "eta_prime": -125.672, "theta_prime": -84.338, "eta_base": -166.570, "theta_base": -73.610, "v0": -14.625, "v1": 38.483, "v2": -45.269, "v3": 38.156, "v4": -15.062, "amplitude": 45.269, "phase_angle": 180.045, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -1.612, -1.940, -2.312 ], "x_axis": [ 0.838, 0.296, 0.459 ], "y_axis": [ -0.481, 0.003, 0.877 ], "z_axis": [ 0.258, -0.955, 0.145 ], "quaternion": [ 0.705, 0.650, -0.071, 0.276 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop", "alpha": 89.740, "beta": 160.641, "gamma": -66.784, "delta": 163.293, "epsilon": -91.516, "zeta": 56.657, "epsilon_zeta": 211.827, "bb_type": "--", "chi": -48.259, "glyco_bond": "--", "C5prime_xyz": [ -4.113, 6.553, -2.726 ], "P_xyz": [ -4.852, 8.615, -4.260 ], "form": ".", "ssZp": 1.619, "Dp": 1.642, "splay_angle": 65.233, "splay_distance": 10.752, "splay_ratio": 0.540, "d22": 8.440, "d64": 10.174, "eta": -140.995, "theta": 59.948, "eta_prime": -101.445, "theta_prime": 63.612, "eta_base": -86.928, "theta_base": 76.404, "v0": -27.054, "v1": 49.377, "v2": -49.597, "v3": 35.027, "v4": -4.073, "amplitude": 51.059, "phase_angle": 166.257, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.025, "origin": [ -1.357, -10.667, 6.934 ], "x_axis": [ -0.200, -0.385, 0.901 ], "y_axis": [ -0.966, -0.075, -0.246 ], "z_axis": [ 0.162, -0.920, -0.357 ], "quaternion": [ -0.304, -0.555, 0.609, -0.479 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -120.126, "beta": -159.022, "gamma": 56.990, "delta": 136.729, "epsilon": -162.939, "zeta": -86.321, "epsilon_zeta": -76.618, "bb_type": "BI", "chi": -166.267, "glyco_bond": "anti", "C5prime_xyz": [ -2.727, 8.791, 0.756 ], "P_xyz": [ -1.850, 9.681, 3.059 ], "form": ".", "ssZp": 1.022, "Dp": 2.200, "splay_angle": 32.356, "splay_distance": 5.672, "splay_ratio": 0.293, "d22": null, "d64": null, "eta": 152.240, "theta": -119.751, "eta_prime": 165.558, "theta_prime": -122.698, "eta_base": 162.712, "theta_base": -99.149, "v0": -43.768, "v1": 51.874, "v2": -40.216, "v3": 16.959, "v4": 16.336, "amplitude": 50.700, "phase_angle": 142.487, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.099, "frame": { "rmsd": 0.013, "origin": [ 0.499, -3.913, -1.223 ], "x_axis": [ 0.203, 0.135, 0.970 ], "y_axis": [ -0.897, -0.373, 0.240 ], "z_axis": [ 0.394, -0.918, 0.046 ], "quaternion": [ 0.468, 0.618, -0.308, 0.551 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -87.873, "beta": -161.644, "gamma": 55.074, "delta": 142.746, "epsilon": -122.071, "zeta": 68.349, "epsilon_zeta": 169.580, "bb_type": "--", "chi": -97.387, "glyco_bond": "anti", "C5prime_xyz": [ -3.655, 8.073, -1.828 ], "P_xyz": [ -2.108, 10.204, -1.905 ], "form": "Z", "ssZp": 2.176, "Dp": 2.142, "splay_angle": 47.414, "splay_distance": 7.008, "splay_ratio": 0.418, "d22": null, "d64": null, "eta": 177.860, "theta": 89.469, "eta_prime": -151.804, "theta_prime": 65.806, "eta_base": -118.018, "theta_base": 80.186, "v0": -40.744, "v1": 53.698, "v2": -44.769, "v3": 22.652, "v4": 11.023, "amplitude": 52.233, "phase_angle": 148.993, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.014, "origin": [ 4.473, -7.648, -2.782 ], "x_axis": [ -0.014, -0.695, 0.719 ], "y_axis": [ -0.910, -0.289, -0.296 ], "z_axis": [ 0.414, -0.659, -0.629 ], "quaternion": [ 0.131, 0.690, -0.582, 0.410 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": 99.447, "beta": -168.176, "gamma": -172.703, "delta": 131.379, "epsilon": 51.504, "zeta": 66.430, "epsilon_zeta": -14.926, "bb_type": "--", "chi": 58.716, "glyco_bond": "syn", "C5prime_xyz": [ -5.260, 4.130, 1.661 ], "P_xyz": [ -5.449, 2.873, 4.028 ], "form": ".", "ssZp": -0.196, "Dp": 1.156, "splay_angle": 29.357, "splay_distance": 5.109, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": -106.155, "theta": 154.151, "eta_prime": -153.424, "theta_prime": -169.415, "eta_base": -167.324, "theta_base": 158.597, "v0": -30.967, "v1": 38.937, "v2": -32.364, "v3": 15.521, "v4": 10.023, "amplitude": 38.540, "phase_angle": 147.113, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 0.816, -2.192, -5.228 ], "x_axis": [ -0.294, 0.235, 0.926 ], "y_axis": [ -0.940, 0.106, -0.325 ], "z_axis": [ -0.175, -0.966, 0.190 ], "quaternion": [ 0.500, 0.320, -0.550, 0.587 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": 61.186, "beta": 174.194, "gamma": -177.970, "delta": 144.610, "epsilon": -174.921, "zeta": -170.519, "epsilon_zeta": -4.402, "bb_type": "--", "chi": -101.313, "glyco_bond": "anti", "C5prime_xyz": [ -2.933, 8.248, -2.057 ], "P_xyz": [ -2.445, 9.041, -4.535 ], "form": ".", "ssZp": 2.178, "Dp": 2.173, "splay_angle": 25.946, "splay_distance": 4.052, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 147.349, "theta": 143.759, "eta_prime": 179.655, "theta_prime": 155.702, "eta_base": 148.315, "theta_base": -136.811, "v0": -36.783, "v1": 51.511, "v2": -47.087, "v3": 27.036, "v4": 6.446, "amplitude": 51.972, "phase_angle": 154.959, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -2.026, 1.288, -2.796 ], "x_axis": [ 0.976, -0.215, -0.044 ], "y_axis": [ -0.033, 0.053, -0.998 ], "z_axis": [ 0.217, 0.975, 0.045 ], "quaternion": [ 0.720, -0.685, 0.091, -0.063 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": 69.393, "beta": 142.006, "gamma": -56.471, "delta": 157.140, "epsilon": -168.379, "zeta": -60.545, "epsilon_zeta": -107.834, "bb_type": "BI", "chi": 80.149, "glyco_bond": "syn", "C5prime_xyz": [ -4.792, 4.081, 1.878 ], "P_xyz": [ -6.804, 2.443, 1.398 ], "form": ".", "ssZp": -2.161, "Dp": 2.235, "splay_angle": 109.411, "splay_distance": 14.188, "splay_ratio": 0.817, "d22": null, "d64": null, "eta": -179.897, "theta": -76.580, "eta_prime": 172.440, "theta_prime": -127.007, "eta_base": -125.051, "theta_base": 179.628, "v0": -12.813, "v1": 32.347, "v2": -37.425, "v3": 31.986, "v4": -12.623, "amplitude": 37.425, "phase_angle": 179.726, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -1.630, 4.981, -4.418 ], "x_axis": [ 0.412, -0.047, 0.910 ], "y_axis": [ -0.836, 0.379, 0.398 ], "z_axis": [ -0.363, -0.924, 0.117 ], "quaternion": [ 0.691, 0.479, -0.461, 0.286 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,ss-non-loop,splayed-apart", "alpha": 105.358, "beta": 171.067, "gamma": 55.596, "delta": 161.754, "epsilon": -105.703, "zeta": -162.620, "epsilon_zeta": 56.918, "bb_type": "BII", "chi": -149.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.260, 8.326, 0.751 ], "P_xyz": [ 0.927, 7.693, 2.270 ], "form": ".", "ssZp": 1.096, "Dp": 1.107, "splay_angle": 67.180, "splay_distance": 10.716, "splay_ratio": 0.554, "d22": 8.401, "d64": 9.883, "eta": -22.018, "theta": -146.908, "eta_prime": 42.392, "theta_prime": -150.608, "eta_base": 27.021, "theta_base": -133.167, "v0": -12.201, "v1": 36.018, "v2": -43.746, "v3": 39.729, "v4": -17.288, "amplitude": 43.839, "phase_angle": 183.739, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.021, "origin": [ -9.921, 16.216, -1.903 ], "x_axis": [ -0.928, 0.024, -0.371 ], "y_axis": [ 0.290, -0.579, -0.762 ], "z_axis": [ -0.234, -0.815, 0.531 ], "quaternion": [ -0.076, -0.174, -0.452, 0.872 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -79.347, "beta": 174.419, "gamma": 62.507, "delta": 143.876, "epsilon": -131.012, "zeta": -68.216, "epsilon_zeta": -62.796, "bb_type": "BI", "chi": -135.775, "glyco_bond": "anti", "C5prime_xyz": [ -2.021, 8.789, -0.257 ], "P_xyz": [ 0.376, 9.307, 0.727 ], "form": ".", "ssZp": 1.935, "Dp": 1.997, "splay_angle": 98.784, "splay_distance": 12.375, "splay_ratio": 0.773, "d22": null, "d64": null, "eta": -152.233, "theta": -63.123, "eta_prime": -145.914, "theta_prime": -76.181, "eta_base": -137.017, "theta_base": -25.320, "v0": -22.950, "v1": 36.481, "v2": -35.958, "v3": 23.989, "v4": -0.368, "amplitude": 37.721, "phase_angle": 162.415, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.065, "filter_rmsd": 0.101, "frame": { "rmsd": 0.020, "origin": [ -2.203, 11.835, 4.103 ], "x_axis": [ -0.932, -0.361, 0.021 ], "y_axis": [ -0.004, -0.048, -0.999 ], "z_axis": [ 0.361, -0.931, 0.043 ], "quaternion": [ -0.125, 0.134, -0.678, 0.711 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart", "alpha": -92.083, "beta": -132.064, "gamma": 56.215, "delta": 156.193, "epsilon": -172.365, "zeta": 138.014, "epsilon_zeta": 49.621, "bb_type": "--", "chi": 143.209, "glyco_bond": "--", "C5prime_xyz": [ -2.456, 6.096, 3.313 ], "P_xyz": [ -2.592, 3.618, 4.360 ], "form": ".", "ssZp": 0.160, "Dp": 1.653, "splay_angle": 52.451, "splay_distance": 7.649, "splay_ratio": 0.444, "d22": null, "d64": null, "eta": 154.945, "theta": 166.344, "eta_prime": -154.038, "theta_prime": 145.533, "eta_base": -120.177, "theta_base": 102.110, "v0": -5.908, "v1": 30.332, "v2": -41.423, "v3": 38.895, "v4": -21.032, "amplitude": 42.132, "phase_angle": 190.525, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.260, "filter_rmsd": 0.038, "frame": { "rmsd": 0.013, "origin": [ 0.831, 8.104, -7.299 ], "x_axis": [ -0.946, -0.170, 0.275 ], "y_axis": [ 0.311, -0.245, 0.918 ], "z_axis": [ -0.089, 0.954, 0.285 ], "quaternion": [ -0.153, 0.059, 0.595, 0.787 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": 87.039, "beta": -76.855, "gamma": 176.165, "delta": 144.743, "epsilon": -174.228, "zeta": -77.889, "epsilon_zeta": -96.339, "bb_type": "BI", "chi": -111.741, "glyco_bond": "anti", "C5prime_xyz": [ -2.810, 8.347, -1.834 ], "P_xyz": [ -1.014, 7.319, -3.586 ], "form": ".", "ssZp": 1.764, "Dp": 2.152, "splay_angle": 21.261, "splay_distance": 3.327, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 72.935, "theta": -39.594, "eta_prime": -152.693, "theta_prime": 162.434, "eta_base": 177.157, "theta_base": -136.784, "v0": -35.152, "v1": 48.552, "v2": -43.194, "v3": 24.267, "v4": 6.800, "amplitude": 48.259, "phase_angle": 153.515, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 2.214, 3.749, -1.165 ], "x_axis": [ -0.344, -0.182, -0.921 ], "y_axis": [ 0.931, 0.056, -0.359 ], "z_axis": [ 0.117, -0.982, 0.150 ], "quaternion": [ -0.464, -0.335, -0.559, 0.600 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -68.188, "beta": -92.726, "gamma": -54.979, "delta": 152.466, "epsilon": -170.183, "zeta": -88.803, "epsilon_zeta": -81.380, "bb_type": "BI", "chi": 78.454, "glyco_bond": "syn", "C5prime_xyz": [ -4.827, 4.052, 2.091 ], "P_xyz": [ -7.256, 4.358, 3.218 ], "form": ".", "ssZp": -1.624, "Dp": 1.697, "splay_angle": 20.495, "splay_distance": 3.522, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 169.213, "theta": -177.519, "eta_prime": 161.525, "theta_prime": -155.535, "eta_base": -139.339, "theta_base": -174.808, "v0": -17.082, "v1": 36.835, "v2": -41.726, "v3": 33.986, "v4": -10.846, "amplitude": 41.830, "phase_angle": 175.954, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 2.520, 0.460, -0.779 ], "x_axis": [ -0.989, 0.073, 0.132 ], "y_axis": [ 0.138, 0.079, 0.987 ], "z_axis": [ 0.062, 0.994, -0.088 ], "quaternion": [ -0.024, 0.072, 0.734, 0.675 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -62.604, "beta": 152.360, "gamma": 63.359, "delta": 140.519, "epsilon": -135.250, "zeta": -85.213, "epsilon_zeta": -50.037, "bb_type": "BI", "chi": -99.354, "glyco_bond": "anti", "C5prime_xyz": [ -3.598, 8.149, -1.919 ], "P_xyz": [ -1.523, 9.534, -2.802 ], "form": ".", "ssZp": 2.048, "Dp": 2.158, "splay_angle": 54.080, "splay_distance": 8.359, "splay_ratio": 0.455, "d22": null, "d64": null, "eta": 173.234, "theta": -95.809, "eta_prime": -138.191, "theta_prime": -165.448, "eta_base": -160.158, "theta_base": 160.310, "v0": -39.334, "v1": 51.349, "v2": -43.172, "v3": 21.683, "v4": 10.588, "amplitude": 50.324, "phase_angle": 149.079, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 0.756, -2.329, 0.455 ], "x_axis": [ 0.450, -0.114, -0.886 ], "y_axis": [ 0.871, -0.163, 0.463 ], "z_axis": [ -0.197, -0.980, 0.026 ], "quaternion": [ 0.573, 0.630, 0.300, -0.430 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,ss-non-loop", "alpha": 177.502, "beta": 119.479, "gamma": 62.648, "delta": 146.916, "epsilon": 162.510, "zeta": 59.098, "epsilon_zeta": 103.412, "bb_type": "--", "chi": -143.042, "glyco_bond": "anti", "C5prime_xyz": [ -2.396, 8.878, 0.040 ], "P_xyz": [ 0.164, 8.997, 0.702 ], "form": ".", "ssZp": 0.898, "Dp": 2.385, "splay_angle": 83.368, "splay_distance": 11.077, "splay_ratio": 0.666, "d22": 8.104, "d64": 9.633, "eta": -18.374, "theta": 79.744, "eta_prime": 83.114, "theta_prime": -52.716, "eta_base": 90.419, "theta_base": -114.091, "v0": -29.738, "v1": 47.666, "v2": -47.150, "v3": 31.831, "v4": -1.540, "amplitude": 49.273, "phase_angle": 163.120, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.010, "filter_rmsd": 0.099, "frame": { "rmsd": 0.020, "origin": [ -4.852, -4.717, 6.174 ], "x_axis": [ -0.048, 0.972, 0.230 ], "y_axis": [ 0.925, -0.044, 0.377 ], "z_axis": [ 0.376, 0.231, -0.897 ], "quaternion": [ 0.053, 0.688, 0.689, 0.220 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": 78.588, "beta": 170.689, "gamma": 67.139, "delta": 151.467, "epsilon": -164.969, "zeta": -77.553, "epsilon_zeta": -87.416, "bb_type": "BI", "chi": -123.296, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.428, -0.866 ], "P_xyz": [ 0.987, 8.648, -0.557 ], "form": ".", "ssZp": 2.034, "Dp": 1.865, "splay_angle": 31.602, "splay_distance": 5.049, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": -29.073, "theta": -89.647, "eta_prime": 72.028, "theta_prime": -113.007, "eta_base": 138.497, "theta_base": -64.254, "v0": -11.840, "v1": 31.023, "v2": -36.498, "v3": 32.433, "v4": -12.916, "amplitude": 36.507, "phase_angle": 181.268, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.098, "frame": { "rmsd": 0.026, "origin": [ -0.134, -9.433, -2.669 ], "x_axis": [ -0.876, 0.420, 0.236 ], "y_axis": [ 0.209, -0.111, 0.972 ], "z_axis": [ 0.434, 0.901, 0.010 ], "quaternion": [ 0.075, 0.237, 0.663, 0.707 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -80.005, "beta": -169.979, "gamma": 52.623, "delta": 154.268, "epsilon": 160.375, "zeta": 169.936, "epsilon_zeta": -9.561, "bb_type": "--", "chi": -75.573, "glyco_bond": "anti", "C5prime_xyz": [ -2.791, 7.012, -2.968 ], "P_xyz": [ -0.471, 8.250, -3.468 ], "form": ".", "ssZp": 1.809, "Dp": 1.888, "splay_angle": 32.430, "splay_distance": 4.839, "splay_ratio": 0.306, "d22": null, "d64": null, "eta": 139.651, "theta": 170.220, "eta_prime": -156.100, "theta_prime": 149.796, "eta_base": -98.686, "theta_base": 178.199, "v0": -19.675, "v1": 41.474, "v2": -46.247, "v3": 36.749, "v4": -10.802, "amplitude": 46.457, "phase_angle": 174.543, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.016, "origin": [ 0.454, -5.576, 0.537 ], "x_axis": [ -0.397, 0.024, 0.917 ], "y_axis": [ 0.893, -0.222, 0.392 ], "z_axis": [ 0.213, 0.975, 0.067 ], "quaternion": [ -0.334, 0.435, 0.526, 0.649 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,phosphate", "alpha": 69.625, "beta": 171.898, "gamma": -60.005, "delta": 164.780, "epsilon": 174.457, "zeta": -81.997, "epsilon_zeta": -103.546, "bb_type": "BI", "chi": 69.837, "glyco_bond": "syn", "C5prime_xyz": [ -4.726, 3.567, 1.537 ], "P_xyz": [ -6.511, 1.672, 1.431 ], "form": ".", "ssZp": -1.092, "Dp": 1.519, "splay_angle": 23.667, "splay_distance": 4.282, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": -160.657, "theta": -111.365, "eta_prime": -169.663, "theta_prime": -129.022, "eta_base": -156.127, "theta_base": -159.211, "v0": -16.424, "v1": 41.343, "v2": -49.261, "v3": 42.054, "v4": -16.095, "amplitude": 49.261, "phase_angle": 180.144, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 3.034, -2.663, -2.339 ], "x_axis": [ -0.884, 0.220, -0.412 ], "y_axis": [ 0.421, -0.010, -0.907 ], "z_axis": [ -0.204, -0.975, -0.084 ], "quaternion": [ 0.075, 0.229, 0.700, -0.673 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": 122.006, "beta": -167.711, "gamma": -174.613, "delta": 152.648, "epsilon": -57.222, "zeta": -178.396, "epsilon_zeta": 121.174, "bb_type": "BII", "chi": -116.328, "glyco_bond": "anti", "C5prime_xyz": [ -2.873, 8.594, -1.188 ], "P_xyz": [ -1.827, 9.990, -3.204 ], "form": ".", "ssZp": 0.559, "Dp": 1.312, "splay_angle": 22.174, "splay_distance": 3.426, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": -150.200, "theta": 156.029, "eta_prime": -138.241, "theta_prime": 168.882, "eta_base": -171.805, "theta_base": -135.419, "v0": -37.500, "v1": 54.111, "v2": -48.306, "v3": 28.262, "v4": 5.829, "amplitude": 53.279, "phase_angle": 155.047, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 1.459, 0.796, -4.312 ], "x_axis": [ 0.062, -0.228, 0.972 ], "y_axis": [ 0.993, -0.084, -0.083 ], "z_axis": [ 0.101, 0.970, 0.221 ], "quaternion": [ 0.547, -0.481, -0.398, -0.558 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", null ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": -53.169, "beta": -159.051, "gamma": -61.544, "delta": 157.405, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 67.482, "glyco_bond": "syn", "C5prime_xyz": [ -5.130, 3.997, 1.716 ], "P_xyz": [ -7.512, 3.098, 2.506 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.191, "v1": 45.033, "v2": -45.548, "v3": 32.387, "v4": -3.818, "amplitude": 46.948, "phase_angle": 165.974, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 1.930, 4.156, -4.789 ], "x_axis": [ -0.924, 0.010, 0.381 ], "y_axis": [ -0.372, 0.201, -0.906 ], "z_axis": [ -0.086, -0.980, -0.182 ], "quaternion": [ -0.154, -0.119, 0.760, -0.621 ] } } ], "num_hbonds": 38, "hbonds": [ { "index": 1, "atom1_serNum": 14, "atom2_serNum": 308, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/1/N6", "atom2_id": "///A/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 14, "atom2_serNum": 402, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///A/1/N6", "atom2_id": "///A/13/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 44, "atom2_serNum": 440, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/2/N7", "atom2_id": "///A/14/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 47, "atom2_serNum": 438, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/2/O6", "atom2_id": "///A/14/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 48, "atom2_serNum": 308, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/2/N1", "atom2_id": "///A/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 50, "atom2_serNum": 305, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/2/N2", "atom2_id": "///A/10/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 77, "atom2_serNum": 278, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/3/N7", "atom2_id": "///A/9/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 80, "atom2_serNum": 276, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/3/O6", "atom2_id": "///A/9/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 81, "atom2_serNum": 470, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/3/N1", "atom2_id": "///A/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 83, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/3/N2", "atom2_id": "///A/15/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 110, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/4/N7", "atom2_id": "///A/16/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 113, "atom2_serNum": 470, "donAcc_type": "questionable", "distance": 3.092, "atom1_id": "///A/4/O6", "atom2_id": "///A/15/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 113, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/4/O6", "atom2_id": "///A/16/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 114, "atom2_serNum": 242, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/4/N1", "atom2_id": "///A/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 116, "atom2_serNum": 239, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/4/N2", "atom2_id": "///A/8/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 143, "atom2_serNum": 553, "donAcc_type": "questionable", "distance": 3.326, "atom1_id": "///A/5/O2", "atom2_id": "///A/18/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 144, "atom2_serNum": 533, "donAcc_type": "standard", "distance": 3.700, "atom1_id": "///A/5/N3", "atom2_id": "///A/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 175, "atom2_serNum": 200, "donAcc_type": "questionable", "distance": 3.201, "atom1_id": "///A/6/O2", "atom2_id": "///A/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 176, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/6/N3", "atom2_id": "///A/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 178, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/6/O4", "atom2_id": "///A/16/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 178, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/6/O4", "atom2_id": "///A/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 178, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///A/6/O4", "atom2_id": "///A/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 207, "atom2_serNum": 566, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/7/N7", "atom2_id": "///A/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 210, "atom2_serNum": 565, "donAcc_type": "standard", "distance": 2.424, "atom1_id": "///A/7/N6", "atom2_id": "///A/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 210, "atom2_serNum": 590, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/7/N6", "atom2_id": "///A/19/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 243, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/8/N1", "atom2_id": "///A/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 245, "atom2_serNum": 629, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/8/N2", "atom2_id": "///A/20/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 272, "atom2_serNum": 668, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/9/N7", "atom2_id": "///A/21/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 275, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/9/O6", "atom2_id": "///A/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 309, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/10/N1", "atom2_id": "///A/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 311, "atom2_serNum": 695, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/10/N2", "atom2_id": "///A/22/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 434, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/14/N7", "atom2_id": "///A/22/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 437, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/14/O6", "atom2_id": "///A/22/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 471, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/15/N1", "atom2_id": "///A/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 473, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/15/N2", "atom2_id": "///A/21/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 500, "atom2_serNum": 635, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/16/N7", "atom2_id": "///A/20/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 503, "atom2_serNum": 633, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/16/O6", "atom2_id": "///A/20/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 618, "atom2_serNum": 635, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/20/OP2", "atom2_id": "///A/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "https://x3dna.org/", "web_dssr": "https://web.x3dna-dssr.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "143d", "num_naChains": 1, "naChains": "A=22", "num_atoms": 715, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }