**************************************************************************** File name: 143d.pdb no. of DNA/RNA chains: 1 [A=22] no. of nucleotides: 22 no. of atoms: 715 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 17 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.DA1 A.DA13 A-A -- -- cHH cM-M 2 A.DG2 A.DG10 G+G -- 06-VI cWH cW+M 3 A.DG2 A.DG14 G+G -- 06-VI cHW cM+W 4 A.DG3 A.DG9 G+G -- 06-VI cHW cM+W 5 A.DG3 A.DG15 G+G -- 06-VI cWH cW+M 6 A.DG4 A.DG8 G+G -- 06-VI cWH cW+M 7 A.DG4 A.DG15 G-G -- -- cHH cM-M 8 A.DG4 A.DG16 G+G -- 06-VI cHW cM+W 9 A.DT6 A.DG16 T+G rWobble 27-XXVII tWW tW+W 10 A.DT6 A.DA19 T-A -- -- cWW cW-W 11 A.DA7 A.DT18 A-T rHoogsteen 24-XXIV tHW tM-W 12 A.DG8 A.DG20 G+G -- 06-VI cWH cW+M 13 A.DG9 A.DG21 G+G -- 06-VI cHW cM+W 14 A.DG10 A.DG22 G+G -- 06-VI cWH cW+M 15 A.DG14 A.DG22 G+G -- 06-VI cHW cM+W 16 A.DG15 A.DG21 G+G -- 06-VI cWH cW+M 17 A.DG16 A.DG20 G+G -- 06-VI cHW cM+W **************************************************************************** List of 3 multiplets 1 nts=4 GGGG A.DG2,A.DG10,A.DG14,A.DG22 2 nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 3 nts=4 GGGG A.DG4,A.DG8,A.DG16,A.DG20 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=6 strand-1 5'-AGGGTA-3' bp-type ....|. strand-2 5'-AGGGAT-3' helix-form ...x. 1 A.DA1 A.DA13 A-A -- -- cHH cM-M 2 A.DG2 A.DG14 G+G -- 06-VI cHW cM+W 3 A.DG3 A.DG15 G+G -- 06-VI cWH cW+M 4 A.DG4 A.DG16 G+G -- 06-VI cHW cM+W 5 A.DT6 A.DA19 T-A WC 20-XX cWW cW-W 6 A.DA7 A.DT18 A-T rHoogsteen 24-XXIV tHW tM-W -------------------------------------------------------------------------- helix#2[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 A.DG8 A.DG20 G+G -- 06-VI cWH cW+M 2 A.DG9 A.DG21 G+G -- 06-VI cHW cM+W 3 A.DG10 A.DG22 G+G -- 06-VI cWH cW+M **************************************************************************** List of 4 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=3 GGG A.DG8,A.DG9,A.DG10 2 nts=4 AGGG A.DA13,A.DG22,A.DG21,A.DG20 3 nts=5 GGGAT A.DG14,A.DG15,A.DG16,A.DA19,A.DT18 4 nts=6 TGGGAT A.DT6,A.DG4,A.DG3,A.DG2,A.DA1,A.DT12 **************************************************************************** Nucleotides not involved in stacking interactions nts=4 TATT A.DT5,A.DA7,A.DT11,A.DT17 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=22 AGGGTTAGGGTTAGGGTTAGGG A.DA1,A.DG2,A.DG3,A.DG4,A.DT5,A.DT6,A.DA7,A.DG8,A.DG9,A.DG10,A.DT11,A.DT12,A.DA13,A.DG14,A.DG15,A.DG16,A.DT17,A.DT18,A.DA19,A.DG20,A.DG21,A.DG22 **************************************************************************** List of 3 G-tetrads 1 glyco-bond=-ss- sugar=---- groove=w-n- planarity=0.412 type=other nts=4 GGGG A.DG2,A.DG10,A.DG22,A.DG14 2 glyco-bond=s--s sugar=.--- groove=w-n- planarity=0.275 type=bowl nts=4 GGGG A.DG3,A.DG9,A.DG21,A.DG15 3 glyco-bond=-ss- sugar=---- groove=w-n- planarity=0.341 type=other nts=4 GGGG A.DG4,A.DG8,A.DG20,A.DG16 **************************************************************************** List of 1 G4-helix Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem. helix#1[1] stems=[#1] layers=3 INTRA-molecular 1 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG10,A.DG22,A.DG14 2 glyco-bond=s--s sugar=.--- groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG9,A.DG21,A.DG15 3 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG20,A.DG16 step#1 pp(><,inward) area=15.12 rise=3.70 twist=36.6 step#2 mm(<>,outward) area=14.88 rise=3.71 twist=11.7 strand#1 DNA glyco-bond=-s- sugar=-.- nts=3 GGG A.DG2,A.DG3,A.DG4 strand#2 DNA glyco-bond=s-s sugar=--- nts=3 GGG A.DG10,A.DG9,A.DG8 strand#3 DNA glyco-bond=s-s sugar=--- nts=3 GGG A.DG22,A.DG21,A.DG20 strand#4 DNA glyco-bond=-s- sugar=--- nts=3 GGG A.DG14,A.DG15,A.DG16 **************************************************************************** List of 1 G4-stem Note: a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands. stem#1[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-LwD+Ln) note=2+2 UDDU anti-parallel:basket 1 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG2,A.DG10,A.DG22,A.DG14 2 glyco-bond=s--s sugar=.--- groove=w-n- Major-->WC nts=4 GGGG A.DG3,A.DG9,A.DG21,A.DG15 3 glyco-bond=-ss- sugar=---- groove=w-n- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG20,A.DG16 step#1 pp(><,inward) area=15.12 rise=3.70 twist=36.6 step#2 mm(<>,outward) area=14.88 rise=3.71 twist=11.7 strand#1 U DNA glyco-bond=-s- sugar=-.- nts=3 GGG A.DG2,A.DG3,A.DG4 strand#2 D DNA glyco-bond=s-s sugar=--- nts=3 GGG A.DG10,A.DG9,A.DG8 strand#3 D DNA glyco-bond=s-s sugar=--- nts=3 GGG A.DG22,A.DG21,A.DG20 strand#4 U DNA glyco-bond=-s- sugar=--- nts=3 GGG A.DG14,A.DG15,A.DG16 loop#1 type=lateral strands=[#1,#2] nts=3 TTA A.DT5,A.DT6,A.DA7 loop#2 type=diagonal strands=[#2,#4] nts=3 TTA A.DT11,A.DT12,A.DA13 loop#3 type=lateral strands=[#4,#3] nts=3 TTA A.DT17,A.DT18,A.DA19 **************************************************************************** List of 2 splayed-apart dinucleotides 1 A.DG10 A.DT11 angle=109 distance=14.2 ratio=0.82 2 A.DT12 A.DA13 angle=99 distance=12.4 ratio=0.77 ---------------------------------------------------------------- Summary of 2 splayed-apart units 1 nts=2 GT A.DG10,A.DT11 2 nts=2 TA A.DT12,A.DA13 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >143d nts=22 [whole] AGGGTTAGGGTTAGGGTTAGGG ...................... >143d-A #1 nts=22 0.47(2.73) [chain] DNA AGGGTTAGGGTTAGGGTTAGGG ...................... **************************************************************************** Summary of structural features of 22 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 A . A.DA1 0.011 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 2 G . A.DG2 0.014 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 3 G . A.DG3 0.015 syn,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 4 G . A.DG4 0.013 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 5 T . A.DT5 0.025 turn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop 6 T . A.DT6 0.013 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 7 A . A.DA7 0.014 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,ss-non-loop 8 G . A.DG8 0.017 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 9 G . A.DG9 0.017 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 10 G . A.DG10 0.013 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 11 T . A.DT11 0.021 anti,~C2'-endo,BII,non-stack,ss-non-loop,splayed-apart 12 T . A.DT12 0.020 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 13 A . A.DA13 0.013 ~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart 14 G . A.DG14 0.010 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 15 G . A.DG15 0.011 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 16 G . A.DG16 0.011 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 17 T . A.DT17 0.020 turn,anti,~C2'-endo,non-stack,ss-non-loop 18 T . A.DT18 0.026 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 19 A . A.DA19 0.016 anti,~C2'-endo,non-canonical,non-pair-contact,helix,ss-non-loop 20 G . A.DG20 0.009 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,phosphate 21 G . A.DG21 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 22 G . A.DG22 0.010 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia