{ "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 174.244, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.601, "chi2": -154.972, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.326, "C1C1_dist": 10.978, "N1N9_dist": 9.164, "C6C8_dist": 9.939, "CNNC_torsion": 0.672, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[3.14],N2(amino)-O2(carbonyl)[3.20]", "interBase_angle": 0.981, "planarity": 0.011, "simple_Shear": -0.659, "simple_Stretch": -0.023, "simple_Buckle": 0.718, "simple_Propeller": 0.669, "bp_simpleParams": [ -0.659, -0.023, 0.032, 0.718, 0.669, -4.845 ], "bp_params": [ -0.656, -0.064, 0.032, 0.674, 0.712, -4.845 ], "frame": { "rmsd": null, "origin": [ -3.710, -17.696, -2.887 ], "x_axis": [ -0.030, -0.277, -0.960 ], "y_axis": [ -0.895, 0.436, -0.098 ], "z_axis": [ 0.446, 0.856, -0.261 ], "quaternion": [ 0.535, -0.446, 0.657, 0.288 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.996, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.503, "chi2": -154.971, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.373, "C1C1_dist": 10.565, "N1N9_dist": 8.898, "C6C8_dist": 9.821, "CNNC_torsion": -0.603, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 0.735, "planarity": 0.020, "simple_Shear": -0.923, "simple_Stretch": -0.125, "simple_Buckle": -0.725, "simple_Propeller": -0.122, "bp_simpleParams": [ -0.923, -0.125, 0.052, -0.725, -0.122, 2.087 ], "bp_params": [ -0.908, -0.206, 0.052, -0.711, -0.186, 2.087 ], "frame": { "rmsd": null, "origin": [ -0.721, -14.332, -3.918 ], "x_axis": [ -0.459, 0.104, -0.882 ], "y_axis": [ -0.764, 0.461, 0.452 ], "z_axis": [ 0.454, 0.881, -0.132 ], "quaternion": [ 0.466, -0.230, 0.716, 0.465 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.890, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.796, "chi2": -167.259, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.155, "C1C1_dist": 11.005, "N1N9_dist": 9.092, "C6C8_dist": 9.751, "CNNC_torsion": -0.964, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.09],O4(carbonyl)-N6(amino)[2.71]", "interBase_angle": 0.941, "planarity": 0.021, "simple_Shear": 0.590, "simple_Stretch": -0.116, "simple_Buckle": -0.203, "simple_Propeller": -0.919, "bp_simpleParams": [ 0.590, -0.116, 0.086, -0.203, -0.919, -11.622 ], "bp_params": [ 0.582, -0.150, 0.086, -0.255, -0.906, -11.622 ], "frame": { "rmsd": null, "origin": [ 2.043, -12.143, -5.317 ], "x_axis": [ -0.949, 0.072, -0.306 ], "y_axis": [ -0.252, 0.409, 0.877 ], "z_axis": [ 0.188, 0.910, -0.370 ], "quaternion": [ 0.149, -0.054, 0.826, 0.541 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/21", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.962, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.259, "chi2": -169.244, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.445, "C1C1_dist": 10.841, "N1N9_dist": 9.066, "C6C8_dist": 9.883, "CNNC_torsion": 2.467, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 1.391, "planarity": 0.020, "simple_Shear": -0.899, "simple_Stretch": -0.002, "simple_Buckle": 1.317, "simple_Propeller": 0.447, "bp_simpleParams": [ -0.899, -0.002, -0.078, 1.317, 0.447, -4.926 ], "bp_params": [ -0.894, -0.086, -0.078, 1.269, 0.570, -4.925 ], "frame": { "rmsd": null, "origin": [ 2.503, -8.907, -8.142 ], "x_axis": [ -0.942, 0.323, 0.093 ], "y_axis": [ 0.203, 0.326, 0.923 ], "z_axis": [ 0.268, 0.889, -0.372 ], "quaternion": [ 0.054, 0.162, 0.812, 0.558 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -139.809, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.857, "chi2": -155.421, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.939, "C1C1_dist": 10.644, "N1N9_dist": 8.929, "C6C8_dist": 9.807, "CNNC_torsion": -0.842, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.81]", "interBase_angle": 0.991, "planarity": 0.016, "simple_Shear": -0.100, "simple_Stretch": -0.182, "simple_Buckle": -0.258, "simple_Propeller": -0.957, "bp_simpleParams": [ -0.100, -0.182, 0.053, -0.258, -0.957, -0.618 ], "bp_params": [ -0.097, -0.183, 0.053, -0.245, -0.961, -0.618 ], "frame": { "rmsd": null, "origin": [ 2.150, -5.692, -10.004 ], "x_axis": [ -0.715, 0.020, 0.699 ], "y_axis": [ 0.687, 0.209, 0.696 ], "z_axis": [ -0.132, 0.978, -0.164 ], "quaternion": [ -0.288, 0.245, 0.722, 0.579 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/18", "bp": "C-A", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.834, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 70.299, "chi2": -159.337, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.475, "C1C1_dist": 10.080, "N1N9_dist": 8.554, "C6C8_dist": 9.563, "CNNC_torsion": -4.947, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)*N1[2.43],N3-N6(amino)[2.78]", "unusual_base2base_hbonds": 1, "interBase_angle": 6.883, "planarity": 0.078, "simple_Shear": 2.357, "simple_Stretch": -0.050, "simple_Buckle": 5.884, "simple_Propeller": -3.571, "bp_simpleParams": [ 2.357, -0.050, -0.220, 5.884, -3.571, 7.897 ], "bp_params": [ 2.281, -0.596, -0.220, 4.896, -4.838, 7.897 ], "frame": { "rmsd": null, "origin": [ 1.009, -0.226, -6.214 ], "x_axis": [ 0.216, -0.009, 0.976 ], "y_axis": [ 0.970, -0.115, -0.215 ], "z_axis": [ 0.115, 0.993, -0.016 ], "quaternion": [ 0.521, -0.580, -0.414, -0.470 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.474, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.698, "chi2": -156.670, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.631, "C1C1_dist": 10.713, "N1N9_dist": 8.935, "C6C8_dist": 9.741, "CNNC_torsion": -6.786, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 4.505, "planarity": 0.065, "simple_Shear": 0.528, "simple_Stretch": -0.227, "simple_Buckle": -3.075, "simple_Propeller": -3.292, "bp_simpleParams": [ 0.528, -0.227, 0.086, -3.075, -3.292, -3.393 ], "bp_params": [ 0.516, -0.253, 0.086, -3.237, -3.133, -3.392 ], "frame": { "rmsd": null, "origin": [ -0.731, 3.718, -6.067 ], "x_axis": [ 0.524, -0.197, 0.829 ], "y_axis": [ 0.841, -0.036, -0.540 ], "z_axis": [ 0.136, 0.980, 0.147 ], "quaternion": [ 0.639, -0.594, -0.271, -0.406 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.593, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.340, "chi2": -158.669, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.265, "C1C1_dist": 10.641, "N1N9_dist": 8.986, "C6C8_dist": 9.921, "CNNC_torsion": 2.288, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[3.15]", "interBase_angle": 1.820, "planarity": 0.024, "simple_Shear": 0.698, "simple_Stretch": -0.044, "simple_Buckle": 1.541, "simple_Propeller": 0.968, "bp_simpleParams": [ 0.698, -0.044, -0.072, 1.541, 0.968, 2.261 ], "bp_params": [ 0.694, -0.090, -0.072, 1.602, 0.864, 2.261 ], "frame": { "rmsd": null, "origin": [ 0.131, 6.577, -4.175 ], "x_axis": [ 0.935, -0.171, 0.312 ], "y_axis": [ 0.344, 0.214, -0.914 ], "z_axis": [ 0.090, 0.962, 0.258 ], "quaternion": [ 0.776, -0.605, -0.072, -0.166 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///A/15", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -148.990, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.156, "chi2": -147.445, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.534, "C1C1_dist": 11.011, "N1N9_dist": 9.173, "C6C8_dist": 9.919, "CNNC_torsion": -1.645, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.99],O4(carbonyl)-N6(amino)[2.76]", "interBase_angle": 1.089, "planarity": 0.021, "simple_Shear": -0.849, "simple_Stretch": 0.046, "simple_Buckle": 0.762, "simple_Propeller": -0.778, "bp_simpleParams": [ -0.849, 0.046, 0.051, 0.762, -0.778, -8.116 ], "bp_params": [ -0.849, -0.030, 0.051, 0.828, -0.707, -8.116 ], "frame": { "rmsd": null, "origin": [ -1.275, 9.606, -2.025 ], "x_axis": [ 0.939, -0.311, -0.147 ], "y_axis": [ -0.044, 0.316, -0.948 ], "z_axis": [ 0.341, 0.896, 0.283 ], "quaternion": [ 0.797, -0.579, 0.153, -0.084 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///A/14", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -174.199, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 104.867, "chi2": -171.540, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 15.829, "C1C1_dist": 9.344, "N1N9_dist": 8.365, "C6C8_dist": 8.997, "CNNC_torsion": 12.530, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.26],N2(amino)-N7[3.19],N3-N6(amino)[2.56]", "interBase_angle": 8.725, "planarity": 0.119, "simple_Shear": 7.122, "simple_Stretch": 2.393, "simple_Buckle": -0.531, "simple_Propeller": 8.709, "bp_simpleParams": [ 7.122, 2.393, -0.043, -0.531, 8.709, 11.887 ], "bp_params": [ 6.595, -3.599, -0.043, 6.029, 6.307, 11.888 ], "frame": { "rmsd": null, "origin": [ 0.964, 14.178, -1.768 ], "x_axis": [ 0.422, 0.425, -0.800 ], "y_axis": [ -0.889, 0.023, -0.457 ], "z_axis": [ -0.176, 0.905, 0.388 ], "quaternion": [ 0.677, -0.503, 0.231, 0.485 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGUUCCCCUG", "strand2": "CCAAGAGGAA", "bp_type": "|||||.|||.", "helix_form": ".AAAx....", "helical_rise": 3.330, "helical_rise_std": 0.780, "helical_radius": 9.331, "helical_radius_std": 2.417, "helical_axis": [ 0.316, 0.946, -0.070 ], "point1": [ -3.771, -17.284, -4.664 ], "point2": [ 5.539, 10.631, -6.734 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.656, -0.064, 0.032, 0.674, 0.712, -4.845 ], "step_params": [ -0.056, -1.116, 4.480, -1.644, -7.370, 32.872 ], "heli_params": [ -0.237, -0.280, 4.612, -12.813, 2.858, 33.705 ], "bp2_params": [ -0.908, -0.206, 0.052, -0.711, -0.186, 2.087 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.480, "simple_Twist": 34.386, "simple_hRise": 4.611, "simple_hTwist": 35.181 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.908, -0.206, 0.052, -0.711, -0.186, 2.087 ], "step_params": [ -1.003, -1.677, 3.251, 0.663, 20.626, 39.684 ], "heli_params": [ -3.885, 1.378, 2.152, 28.194, -0.906, 44.537 ], "bp2_params": [ 0.582, -0.150, 0.086, -0.255, -0.906, -11.622 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.251, "simple_Twist": 31.582, "simple_hRise": 1.832, "simple_hTwist": 37.582 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.582, -0.150, 0.086, -0.255, -0.906, -11.622 ], "step_params": [ 0.513, -1.364, 4.068, 0.689, -4.708, 26.882 ], "heli_params": [ -1.387, -0.866, 4.251, -10.028, -1.467, 27.292 ], "bp2_params": [ -0.894, -0.086, -0.078, 1.269, 0.570, -4.925 ], "groove_widths": [ 19.052, null, 14.261, null ], "simple_Rise": 4.068, "simple_Twist": 34.601, "simple_hRise": 4.220, "simple_hTwist": 34.917 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/21", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.894, -0.086, -0.078, 1.269, 0.570, -4.925 ], "step_params": [ 0.122, -1.079, 3.570, -0.906, 26.594, 32.634 ], "heli_params": [ -4.271, -0.265, 2.138, 40.064, 1.364, 41.878 ], "bp2_params": [ -0.097, -0.183, 0.053, -0.245, -0.961, -0.618 ], "groove_widths": [ 20.041, 17.968, 13.170, 12.610 ], "simple_Rise": 3.570, "simple_Twist": 28.377, "simple_hRise": 1.912, "simple_hTwist": 38.713 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.097, -0.183, 0.053, -0.245, -0.961, -0.618 ], "step_params": [ 4.405, 0.165, 5.110, -16.050, 4.148, 58.591 ], "heli_params": [ -0.119, -5.451, 3.898, 4.148, 16.052, 60.690 ], "bp2_params": [ 2.281, -0.596, -0.220, 4.896, -4.838, 7.897 ], "groove_widths": [ 20.431, 17.625, 13.442, 11.902 ], "simple_Rise": 5.110, "simple_Twist": 44.935, "simple_hRise": 3.435, "simple_hTwist": 47.746 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/18", "bp": "C-A", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.281, -0.596, -0.220, 4.896, -4.838, 7.897 ], "step_params": [ -0.949, -2.014, 3.694, 2.416, 9.141, 20.588 ], "heli_params": [ -8.409, 3.284, 2.459, 24.009, -6.346, 22.634 ], "bp2_params": [ 0.516, -0.253, 0.086, -3.237, -3.133, -3.392 ], "groove_widths": [ 20.181, 15.935, 16.235, 14.656 ], "simple_Rise": 3.694, "simple_Twist": 30.907, "simple_hRise": 2.915, "simple_hTwist": 32.287 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.516, -0.253, 0.086, -3.237, -3.133, -3.392 ], "step_params": [ 1.186, -0.669, 3.263, 6.706, 2.007, 38.593 ], "heli_params": [ -1.242, -0.947, 3.377, 3.006, -10.045, 39.199 ], "bp2_params": [ 0.694, -0.090, -0.072, 1.602, 0.864, 2.261 ], "groove_widths": [ 18.770, null, 15.663, null ], "simple_Rise": 3.263, "simple_Twist": 37.645, "simple_hRise": 3.378, "simple_hTwist": 38.267 }, { "index": 8, "nt1": "///A/8", "nt2": "///A/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.694, -0.090, -0.072, 1.602, 0.864, 2.261 ], "step_params": [ -1.926, -1.525, 3.120, 0.148, 15.010, 23.423 ], "heli_params": [ -6.150, 4.044, 1.817, 32.984, -0.325, 27.763 ], "bp2_params": [ -0.849, -0.030, 0.051, 0.828, -0.707, -8.116 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.120, "simple_Twist": 31.677, "simple_hRise": 2.188, "simple_hTwist": 34.971 }, { "index": 9, "nt1": "///A/9", "nt2": "///A/15", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.849, -0.030, 0.051, 0.828, -0.707, -8.116 ], "step_params": [ 2.295, 0.115, 4.549, -11.895, -28.207, 62.424 ], "heli_params": [ 1.515, -2.626, 3.772, -25.652, 10.818, 68.840 ], "bp2_params": [ 6.595, -3.599, -0.043, 6.029, 6.307, 11.888 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.549, "simple_Twist": 12.807, "simple_hRise": 0.861, "simple_hTwist": 33.124 }, { "index": 10, "nt1": "///A/10", "nt2": "///A/14", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGUUC", "strand2": "CCAAG", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 3.410, "helical_rise_std": 0.285, "helical_radius": 8.866, "helical_radius_std": 0.555, "helical_axis": [ 0.229, 0.969, -0.091 ], "point1": [ -3.207, -17.670, -6.417 ], "point2": [ -0.081, -4.446, -7.654 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.656, -0.064, 0.032, 0.674, 0.712, -4.845 ], "step_params": [ -0.056, -1.116, 4.480, -1.644, -7.370, 32.872 ], "heli_params": [ -0.237, -0.280, 4.612, -12.813, 2.858, 33.705 ], "bp2_params": [ -0.908, -0.206, 0.052, -0.711, -0.186, 2.087 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.480, "simple_Twist": 34.386, "simple_hRise": 4.611, "simple_hTwist": 35.181 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.908, -0.206, 0.052, -0.711, -0.186, 2.087 ], "step_params": [ -1.003, -1.677, 3.251, 0.663, 20.626, 39.684 ], "heli_params": [ -3.885, 1.378, 2.152, 28.194, -0.906, 44.537 ], "bp2_params": [ 0.582, -0.150, 0.086, -0.255, -0.906, -11.622 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.251, "simple_Twist": 31.582, "simple_hRise": 1.832, "simple_hTwist": 37.582 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.582, -0.150, 0.086, -0.255, -0.906, -11.622 ], "step_params": [ 0.513, -1.364, 4.068, 0.689, -4.708, 26.882 ], "heli_params": [ -1.387, -0.866, 4.251, -10.028, -1.467, 27.292 ], "bp2_params": [ -0.894, -0.086, -0.078, 1.269, 0.570, -4.925 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.068, "simple_Twist": 34.601, "simple_hRise": 4.220, "simple_hTwist": 34.917 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/21", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.894, -0.086, -0.078, 1.269, 0.570, -4.925 ], "step_params": [ 0.122, -1.079, 3.570, -0.906, 26.594, 32.634 ], "heli_params": [ -4.271, -0.265, 2.138, 40.064, 1.364, 41.878 ], "bp2_params": [ -0.097, -0.183, 0.053, -0.245, -0.961, -0.618 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.570, "simple_Twist": 28.377, "simple_hRise": 1.912, "simple_hTwist": 38.713 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CCU", "strand2": "GGA", "bp_type": "|||", "helix_form": "..", "helical_rise": 3.613, "helical_rise_std": 0.141, "helical_radius": 9.065, "helical_radius_std": 1.397, "helical_axis": [ 0.234, 0.925, 0.301 ], "point1": [ -0.861, 2.438, -4.079 ], "point2": [ 0.881, 9.311, -1.844 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/7", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.516, -0.253, 0.086, -3.237, -3.133, -3.392 ], "step_params": [ 1.186, -0.669, 3.263, 6.706, 2.007, 38.593 ], "heli_params": [ -1.242, -0.947, 3.377, 3.006, -10.045, 39.199 ], "bp2_params": [ 0.694, -0.090, -0.072, 1.602, 0.864, 2.261 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.263, "simple_Twist": 37.645, "simple_hRise": 3.378, "simple_hTwist": 38.267 }, { "index": 2, "nt1": "///A/8", "nt2": "///A/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.694, -0.090, -0.072, 1.602, 0.864, 2.261 ], "step_params": [ -1.926, -1.525, 3.120, 0.148, 15.010, 23.423 ], "heli_params": [ -6.150, 4.044, 1.817, 32.984, -0.325, 27.763 ], "bp2_params": [ -0.849, -0.030, 0.051, 0.828, -0.707, -8.116 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.120, "simple_Twist": 31.677, "simple_hRise": 2.188, "simple_hTwist": 34.971 }, { "index": 3, "nt1": "///A/9", "nt2": "///A/15", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///A/9,///A/10" }, { "index": 2, "num_nts": 3, "nts_short": "CCC", "nts_long": "///A/5,///A/6,///A/7" }, { "index": 3, "num_nts": 3, "nts_short": "AAA", "nts_long": "///A/12,///A/14,///A/15" }, { "index": 4, "num_nts": 4, "nts_short": "GAuG", "nts_long": "///A/17,///A/18,///A/19,///A/20" } ], "nonStack": { "num_nts": 3, "nts_short": "CUC", "nts_long": "///A/11,///A/13,///A/24" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/12/OP1", "nt": "///A/10", "vert_dist": 3.293 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 5 ], "stem_indices": [ 2 ], "summary": "[1] 5 [A.9 A.15] 3", "num_nts": 7, "nts_short": "UGCAUAA", "nts_long": "///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "GCAUA", "nts_long": "///A/10,///A/11,///A/12,///A/13,///A/14" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 2 [A.5 A.20 A.7 A.17] 5 3", "num_nts": 7, "nts_short": "CCCGAuG", "nts_long": "///A/5,///A/6,///A/7,///A/17,///A/18,///A/19,///A/20", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///A/6" }, { "index": 2, "num_nts": 2, "nts_short": "Au", "nts_long": "///A/18,///A/19" } ] } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "GC", "nts_long": "///A/10,///A/11" } ], "dbn": { "all_chains": { "num_nts": 24, "num_chars": 24, "bseq": "GGUUCCCCUGCAUAAGGAuGAACC", "bseqUP": "GGUUCCCCUGCAUAAGGAUGAACC", "sstr": "(((((.(((.....)))..)))))", "form": ".AAA..B.......A....A.A.-" }, "m1_chain_A": { "num_nts": 24, "num_chars": 24, "bseq": "GGUUCCCCUGCAUAAGGAuGAACC", "bseqUP": "GGUUCCCCUGCAUAAGGAUGAACC", "sstr": "(((((.(((.....)))..)))))", "form": ".AAA..B.......A....A.A.-" } }, "chains": { "m1_chain_A": { "num_nts": 24, "bseq": "GGUUCCCCUGCAUAAGGAuGAACC", "sstr": "(((((.(((.....)))..)))))", "form": ".AAA..B.......A....A.A.-", "helical_rise": 0.333, "helical_rise_std": 2.732, "helical_axis": [ 0.974, 0.220, -0.061 ], "point1": [ -11.136, -1.741, 3.367 ], "point2": [ -2.998, 0.100, 2.856 ], "num_chars": 70, "suite": "G1aG1aU1aU1aC!!C!!C1aC1aU!!G!!C!!A!!U!!A1aA1aG&aG1aA1au!!G1aA1aA1aC1aC" } }, "num_nts": 24, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 68.475, "delta": 92.532, "epsilon": -121.436, "zeta": -99.151, "epsilon_zeta": -22.285, "bb_type": "--", "chi": 174.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.194, 2.073 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.640, "Dp": 4.632, "splay_angle": 30.823, "splay_distance": 4.664, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.323, "v1": -25.376, "v2": 33.812, "v3": -31.121, "v4": 15.626, "amplitude": 34.163, "phase_angle": 8.229, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -3.664, -17.606, -2.572 ], "x_axis": [ 0.005, -0.301, -0.954 ], "y_axis": [ -0.892, 0.429, -0.140 ], "z_axis": [ 0.451, 0.852, -0.267 ], "quaternion": [ 0.540, -0.459, 0.650, 0.274 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.180, "beta": 151.610, "gamma": 69.864, "delta": 93.461, "epsilon": -137.603, "zeta": -74.111, "epsilon_zeta": -63.492, "bb_type": "BI", "chi": -168.996, "glyco_bond": "anti", "C5prime_xyz": [ -1.190, 8.510, 1.196 ], "P_xyz": [ 1.406, 8.570, 0.717 ], "form": "A", "ssZp": 4.546, "Dp": 4.637, "splay_angle": 22.676, "splay_distance": 3.721, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 173.707, "theta": -127.305, "eta_prime": -171.084, "theta_prime": -132.604, "eta_base": -132.943, "theta_base": -118.953, "v0": 9.270, "v1": -27.543, "v2": 34.475, "v3": -30.063, "v4": 13.107, "amplitude": 34.537, "phase_angle": 3.429, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.101, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -0.422, -14.404, -3.567 ], "x_axis": [ -0.472, 0.114, -0.874 ], "y_axis": [ -0.758, 0.454, 0.468 ], "z_axis": [ 0.450, 0.884, -0.128 ], "quaternion": [ 0.462, -0.225, 0.717, 0.472 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -86.931, "beta": 177.865, "gamma": 60.952, "delta": 90.769, "epsilon": -168.947, "zeta": -73.280, "epsilon_zeta": -95.667, "bb_type": "BI", "chi": -156.890, "glyco_bond": "anti", "C5prime_xyz": [ -1.717, 8.858, 0.396 ], "P_xyz": [ 0.811, 9.592, 0.614 ], "form": "A", "ssZp": 4.163, "Dp": 4.230, "splay_angle": 26.111, "splay_distance": 4.210, "splay_ratio": 0.227, "d22": 4.982, "d64": 5.078, "eta": 157.310, "theta": -152.255, "eta_prime": 176.567, "theta_prime": -152.280, "eta_base": -148.649, "theta_base": -128.884, "v0": -4.975, "v1": -16.176, "v2": 29.772, "v3": -33.598, "v4": 24.306, "amplitude": 33.416, "phase_angle": 27.008, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.342, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 1.794, -12.114, -5.487 ], "x_axis": [ -0.918, 0.037, -0.396 ], "y_axis": [ -0.347, 0.413, 0.842 ], "z_axis": [ 0.195, 0.910, -0.366 ], "quaternion": [ 0.180, -0.094, 0.821, 0.534 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.825, "beta": -179.293, "gamma": 68.373, "delta": 91.603, "epsilon": -145.591, "zeta": -73.052, "epsilon_zeta": -72.539, "bb_type": "BI", "chi": -151.962, "glyco_bond": "anti", "C5prime_xyz": [ -1.565, 8.832, 0.131 ], "P_xyz": [ 1.010, 9.413, 0.021 ], "form": "A", "ssZp": 4.062, "Dp": 4.435, "splay_angle": 23.596, "splay_distance": 3.984, "splay_ratio": 0.206, "d22": 4.092, "d64": 3.825, "eta": 179.186, "theta": -134.266, "eta_prime": -169.731, "theta_prime": -134.845, "eta_base": -137.919, "theta_base": -110.004, "v0": -1.813, "v1": -18.728, "v2": 30.877, "v3": -32.844, "v4": 21.830, "amplitude": 33.225, "phase_angle": 21.670, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.294, "filter_rmsd": 0.101, "frame": { "rmsd": 0.016, "origin": [ 2.905, -9.100, -8.209 ], "x_axis": [ -0.951, 0.304, 0.056 ], "y_axis": [ 0.165, 0.349, 0.922 ], "z_axis": [ 0.261, 0.886, -0.382 ], "quaternion": [ 0.063, 0.143, 0.819, 0.552 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -54.592, "beta": -177.226, "gamma": 25.081, "delta": 92.130, "epsilon": -135.251, "zeta": -62.051, "epsilon_zeta": -73.200, "bb_type": "BI", "chi": -139.809, "glyco_bond": "anti", "C5prime_xyz": [ -1.489, 8.800, -0.596 ], "P_xyz": [ 0.865, 9.867, -0.054 ], "form": ".", "ssZp": 3.448, "Dp": 4.466, "splay_angle": 46.965, "splay_distance": 7.481, "splay_ratio": 0.402, "d22": 4.149, "d64": 5.138, "eta": 167.125, "theta": -128.746, "eta_prime": 179.941, "theta_prime": -117.590, "eta_base": -144.900, "theta_base": -74.909, "v0": -1.108, "v1": -18.991, "v2": 30.584, "v3": -32.210, "v4": 20.991, "amplitude": 32.666, "phase_angle": 20.566, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.041, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 2.118, -5.686, -10.106 ], "x_axis": [ -0.719, 0.027, 0.694 ], "y_axis": [ 0.683, 0.208, 0.700 ], "z_axis": [ -0.125, 0.978, -0.168 ], "quaternion": [ -0.283, 0.246, 0.724, 0.580 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -87.239, "beta": 134.288, "gamma": 96.881, "delta": 93.226, "epsilon": -97.422, "zeta": -147.735, "epsilon_zeta": 50.313, "bb_type": "--", "chi": -178.834, "glyco_bond": "anti", "C5prime_xyz": [ -0.884, 8.036, 1.721 ], "P_xyz": [ 1.313, 8.617, 0.382 ], "form": ".", "ssZp": 4.661, "Dp": 4.812, "splay_angle": 28.713, "splay_distance": 4.413, "splay_ratio": 0.248, "d22": 4.836, "d64": 5.096, "eta": 179.735, "theta": -163.458, "eta_prime": -151.763, "theta_prime": -155.803, "eta_base": -94.109, "theta_base": -151.507, "v0": 18.895, "v1": -36.607, "v2": 39.758, "v3": -29.836, "v4": 6.983, "amplitude": 40.219, "phase_angle": 351.319, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 0.954, -0.311, -5.034 ], "x_axis": [ 0.286, 0.028, 0.958 ], "y_axis": [ 0.956, -0.075, -0.283 ], "z_axis": [ 0.064, 0.997, -0.048 ], "quaternion": [ 0.539, -0.593, -0.414, -0.430 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -17.967, "beta": 104.128, "gamma": 49.675, "delta": 87.726, "epsilon": -138.789, "zeta": -75.351, "epsilon_zeta": -63.437, "bb_type": "BI", "chi": -166.474, "glyco_bond": "anti", "C5prime_xyz": [ -2.195, 8.945, 0.666 ], "P_xyz": [ 0.430, 8.866, 0.706 ], "form": "B", "ssZp": 3.952, "Dp": 4.173, "splay_angle": 20.694, "splay_distance": 3.456, "splay_ratio": 0.180, "d22": 4.313, "d64": 3.846, "eta": -179.783, "theta": -122.033, "eta_prime": -165.034, "theta_prime": -132.331, "eta_base": -154.540, "theta_base": -94.505, "v0": -16.089, "v1": -7.455, "v2": 26.252, "v3": -36.636, "v4": 33.192, "amplitude": 36.593, "phase_angle": 44.161, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ -0.697, 3.714, -5.779 ], "x_axis": [ 0.503, -0.168, 0.848 ], "y_axis": [ 0.852, -0.068, -0.519 ], "z_axis": [ 0.145, 0.983, 0.109 ], "quaternion": [ 0.621, -0.605, -0.283, -0.411 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -89.388, "beta": 153.969, "gamma": 77.603, "delta": 89.349, "epsilon": -176.257, "zeta": -83.056, "epsilon_zeta": -93.201, "bb_type": "BI", "chi": -152.593, "glyco_bond": "anti", "C5prime_xyz": [ -1.807, 8.968, 0.089 ], "P_xyz": [ 0.582, 9.645, -0.809 ], "form": ".", "ssZp": 4.010, "Dp": 4.112, "splay_angle": 27.378, "splay_distance": 4.424, "splay_ratio": 0.237, "d22": 5.259, "d64": 5.047, "eta": 153.663, "theta": -166.583, "eta_prime": 179.791, "theta_prime": -171.541, "eta_base": -118.244, "theta_base": -168.097, "v0": -9.141, "v1": -13.188, "v2": 28.873, "v3": -35.174, "v4": 27.914, "amplitude": 34.665, "phase_angle": 33.601, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.099, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 0.437, 6.473, -4.036 ], "x_axis": [ 0.941, -0.173, 0.292 ], "y_axis": [ 0.327, 0.231, -0.917 ], "z_axis": [ 0.092, 0.957, 0.274 ], "quaternion": [ 0.782, -0.599, -0.064, -0.160 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -91.260, "beta": -161.633, "gamma": 55.563, "delta": 92.198, "epsilon": -163.642, "zeta": -48.505, "epsilon_zeta": -115.136, "bb_type": "BI", "chi": -148.990, "glyco_bond": "anti", "C5prime_xyz": [ -1.464, 8.786, -0.026 ], "P_xyz": [ 1.054, 9.380, 0.495 ], "form": ".", "ssZp": 4.056, "Dp": 4.359, "splay_angle": 55.431, "splay_distance": 8.222, "splay_ratio": 0.468, "d22": null, "d64": null, "eta": 168.802, "theta": -126.026, "eta_prime": 170.309, "theta_prime": -117.367, "eta_base": -179.277, "theta_base": -83.415, "v0": 1.197, "v1": -21.180, "v2": 31.906, "v3": -32.195, "v4": 19.515, "amplitude": 33.299, "phase_angle": 16.632, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.169, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ -1.664, 9.756, -1.941 ], "x_axis": [ 0.942, -0.327, -0.078 ], "y_axis": [ 0.025, 0.300, -0.954 ], "z_axis": [ 0.336, 0.896, 0.291 ], "quaternion": [ 0.796, -0.581, 0.130, -0.111 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -92.453, "beta": 163.910, "gamma": 90.179, "delta": 95.300, "epsilon": -103.448, "zeta": -80.475, "epsilon_zeta": -22.973, "bb_type": "--", "chi": -174.199, "glyco_bond": "anti", "C5prime_xyz": [ -0.582, 8.045, 1.396 ], "P_xyz": [ 1.816, 8.105, 0.287 ], "form": ".", "ssZp": 4.742, "Dp": 4.867, "splay_angle": 94.686, "splay_distance": 13.059, "splay_ratio": 0.735, "d22": null, "d64": null, "eta": -168.955, "theta": -138.241, "eta_prime": -139.273, "theta_prime": 176.732, "eta_base": -85.275, "theta_base": 109.897, "v0": 22.464, "v1": -38.222, "v2": 38.946, "v3": -26.855, "v4": 2.953, "amplitude": 40.218, "phase_angle": 345.554, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 3.961, 15.520, -3.594 ], "x_axis": [ 0.335, 0.380, -0.862 ], "y_axis": [ -0.936, 0.032, -0.350 ], "z_axis": [ -0.106, 0.924, 0.367 ], "quaternion": [ 0.658, -0.484, 0.287, 0.500 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -96.821, "beta": 90.584, "gamma": 20.101, "delta": 92.109, "epsilon": 158.648, "zeta": -104.241, "epsilon_zeta": -97.112, "bb_type": "BI", "chi": -132.904, "glyco_bond": "anti", "C5prime_xyz": [ -2.379, 8.864, -1.058 ], "P_xyz": [ 0.213, 8.936, -0.548 ], "form": ".", "ssZp": 3.369, "Dp": 3.475, "splay_angle": 24.224, "splay_distance": 4.093, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 40.478, "theta": -168.432, "eta_prime": 57.188, "theta_prime": 175.641, "eta_base": 26.389, "theta_base": 158.922, "v0": -21.494, "v1": 0.228, "v2": 19.163, "v3": -32.308, "v4": 34.040, "amplitude": 34.439, "phase_angle": 56.191, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -6.868, 13.311, 3.363 ], "x_axis": [ -0.637, -0.333, -0.695 ], "y_axis": [ 0.388, 0.640, -0.663 ], "z_axis": [ 0.666, -0.692, -0.279 ], "quaternion": [ 0.425, 0.017, 0.799, -0.424 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -24.584, "beta": 149.265, "gamma": 49.531, "delta": 130.060, "epsilon": -95.636, "zeta": -84.224, "epsilon_zeta": -11.412, "bb_type": "--", "chi": -137.690, "glyco_bond": "anti", "C5prime_xyz": [ -2.599, 8.840, -0.605 ], "P_xyz": [ -0.297, 9.935, 0.060 ], "form": ".", "ssZp": 1.217, "Dp": 1.360, "splay_angle": 33.435, "splay_distance": 5.526, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": -151.353, "theta": -109.011, "eta_prime": -145.481, "theta_prime": -167.543, "eta_base": -160.342, "theta_base": 135.592, "v0": -34.242, "v1": 36.439, "v2": -25.447, "v3": 6.286, "v4": 17.290, "amplitude": 36.769, "phase_angle": 133.794, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.019, "origin": [ -4.532, 12.390, 6.596 ], "x_axis": [ -0.571, -0.401, -0.716 ], "y_axis": [ 0.527, 0.489, -0.695 ], "z_axis": [ 0.629, -0.774, -0.068 ], "quaternion": [ 0.461, 0.043, 0.729, -0.504 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,non-stack,hairpin-loop", "alpha": -22.271, "beta": -68.136, "gamma": 162.254, "delta": 110.358, "epsilon": -62.549, "zeta": -43.150, "epsilon_zeta": -19.399, "bb_type": "--", "chi": 154.725, "glyco_bond": "anti", "C5prime_xyz": [ -3.033, 7.995, 2.433 ], "P_xyz": [ -0.467, 8.319, 1.895 ], "form": ".", "ssZp": 1.654, "Dp": 1.665, "splay_angle": 63.106, "splay_distance": 10.816, "splay_ratio": 0.524, "d22": null, "d64": null, "eta": 101.439, "theta": -88.889, "eta_prime": 104.351, "theta_prime": -83.810, "eta_base": 69.772, "theta_base": -71.125, "v0": -30.260, "v1": 20.134, "v2": -3.947, "v3": -13.517, "v4": 27.523, "amplitude": 29.970, "phase_angle": 97.568, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -3.126, 16.291, 10.248 ], "x_axis": [ -0.414, 0.876, -0.249 ], "y_axis": [ 0.876, 0.308, -0.371 ], "z_axis": [ -0.249, -0.371, -0.895 ], "quaternion": [ -0.000, 0.541, 0.809, -0.230 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -92.538, "beta": 94.856, "gamma": 155.642, "delta": 90.724, "epsilon": -176.495, "zeta": -69.635, "epsilon_zeta": -106.860, "bb_type": "BI", "chi": -171.540, "glyco_bond": "anti", "C5prime_xyz": [ -1.935, 8.724, 1.183 ], "P_xyz": [ -1.981, 10.523, -0.752 ], "form": ".", "ssZp": 4.085, "Dp": 4.086, "splay_angle": 28.308, "splay_distance": 4.175, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -170.384, "theta": 140.818, "eta_prime": -146.138, "theta_prime": 168.265, "eta_base": -106.795, "theta_base": -133.355, "v0": -8.131, "v1": -13.238, "v2": 28.020, "v3": -33.715, "v4": 26.357, "amplitude": 33.227, "phase_angle": 32.513, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.019, "origin": [ -2.032, 12.835, 0.058 ], "x_axis": [ 0.499, 0.474, -0.725 ], "y_axis": [ 0.831, -0.025, 0.556 ], "z_axis": [ 0.246, -0.880, -0.407 ], "quaternion": [ 0.517, 0.695, 0.470, -0.172 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -85.610, "beta": 176.015, "gamma": 77.526, "delta": 101.832, "epsilon": -154.341, "zeta": -57.344, "epsilon_zeta": -96.998, "bb_type": "BI", "chi": -147.445, "glyco_bond": "anti", "C5prime_xyz": [ -0.787, 8.367, -0.058 ], "P_xyz": [ 1.748, 7.971, -0.690 ], "form": "A", "ssZp": 3.989, "Dp": 4.498, "splay_angle": 20.591, "splay_distance": 3.616, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -179.612, "theta": -116.137, "eta_prime": -158.506, "theta_prime": -122.516, "eta_base": -96.612, "theta_base": -105.669, "v0": 17.108, "v1": -30.117, "v2": 31.304, "v3": -22.163, "v4": 3.258, "amplitude": 32.096, "phase_angle": 347.248, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.036, "frame": { "rmsd": 0.019, "origin": [ -0.885, 9.456, -2.109 ], "x_axis": [ 0.931, -0.294, -0.216 ], "y_axis": [ 0.113, -0.331, 0.937 ], "z_axis": [ -0.347, -0.897, -0.275 ], "quaternion": [ 0.575, 0.797, -0.057, -0.177 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.407, "beta": 163.745, "gamma": 55.946, "delta": 92.239, "epsilon": -176.587, "zeta": -87.669, "epsilon_zeta": -88.918, "bb_type": "BI", "chi": -158.669, "glyco_bond": "anti", "C5prime_xyz": [ -2.354, 9.042, 0.283 ], "P_xyz": [ -0.023, 10.233, 0.637 ], "form": ".", "ssZp": 3.798, "Dp": 3.744, "splay_angle": 23.037, "splay_distance": 3.643, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.131, "theta": -168.462, "eta_prime": -163.087, "theta_prime": -169.457, "eta_base": -119.227, "theta_base": -137.551, "v0": -22.429, "v1": 1.309, "v2": 18.363, "v3": -32.140, "v4": 34.417, "amplitude": 34.612, "phase_angle": 57.958, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.118, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ -0.174, 6.681, -4.315 ], "x_axis": [ 0.928, -0.167, 0.332 ], "y_axis": [ -0.361, -0.197, 0.911 ], "z_axis": [ -0.087, -0.966, -0.243 ], "quaternion": [ 0.610, 0.770, -0.172, 0.079 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -83.191, "beta": -170.417, "gamma": 51.457, "delta": 92.996, "epsilon": 178.884, "zeta": -42.095, "epsilon_zeta": -139.021, "bb_type": "BI", "chi": -156.670, "glyco_bond": "anti", "C5prime_xyz": [ -1.039, 8.650, 0.456 ], "P_xyz": [ 1.542, 8.788, 1.010 ], "form": ".", "ssZp": 4.199, "Dp": 4.301, "splay_angle": 25.565, "splay_distance": 4.398, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 164.579, "theta": -128.562, "eta_prime": 171.807, "theta_prime": -130.020, "eta_base": -146.219, "theta_base": -115.907, "v0": 9.815, "v1": -28.479, "v2": 35.465, "v3": -30.734, "v4": 13.156, "amplitude": 35.512, "phase_angle": 2.934, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.402, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -0.766, 3.722, -6.356 ], "x_axis": [ 0.545, -0.224, 0.808 ], "y_axis": [ -0.829, 0.001, 0.560 ], "z_axis": [ -0.126, -0.975, -0.185 ], "quaternion": [ 0.584, 0.657, -0.400, 0.259 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -99.172, "beta": -163.044, "gamma": 72.527, "delta": 92.604, "epsilon": -155.603, "zeta": -94.546, "epsilon_zeta": -61.057, "bb_type": "BI", "chi": -159.337, "glyco_bond": "anti", "C5prime_xyz": [ -2.247, 8.975, 0.295 ], "P_xyz": [ -0.001, 10.108, 1.105 ], "form": ".", "ssZp": 3.719, "Dp": 3.858, "splay_angle": 16.972, "splay_distance": 2.818, "splay_ratio": 0.148, "d22": null, "d64": null, "eta": 179.495, "theta": -164.017, "eta_prime": -160.508, "theta_prime": -166.311, "eta_base": -131.098, "theta_base": -160.536, "v0": -20.459, "v1": -0.043, "v2": 18.647, "v3": -31.255, "v4": 32.645, "amplitude": 33.140, "phase_angle": 55.759, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.018, "origin": [ 1.065, -0.140, -7.393 ], "x_axis": [ 0.143, -0.040, 0.989 ], "y_axis": [ -0.976, 0.161, 0.148 ], "z_axis": [ -0.165, -0.986, -0.016 ], "quaternion": [ 0.567, 0.500, -0.508, 0.412 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "SSU", "nt_code": "u", "is_modified": true, "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -86.461, "beta": 158.519, "gamma": 66.054, "delta": 89.429, "epsilon": -142.905, "zeta": -98.710, "epsilon_zeta": -44.196, "bb_type": "BI", "chi": -148.803, "glyco_bond": "anti", "C5prime_xyz": [ -1.789, 8.894, -0.072 ], "P_xyz": [ 0.682, 9.513, -0.768 ], "form": ".", "ssZp": 3.961, "Dp": 4.423, "splay_angle": 21.846, "splay_distance": 3.607, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 160.888, "theta": -164.550, "eta_prime": 167.901, "theta_prime": -166.601, "eta_base": -178.081, "theta_base": -142.613, "v0": -6.151, "v1": -15.952, "v2": 30.482, "v3": -35.032, "v4": 25.923, "amplitude": 34.719, "phase_angle": 28.602, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.243, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 1.917, -2.183, -9.138 ], "x_axis": [ -0.254, -0.119, 0.960 ], "y_axis": [ -0.959, -0.097, -0.265 ], "z_axis": [ 0.124, -0.988, -0.090 ], "quaternion": [ 0.374, 0.483, -0.558, 0.561 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -102.850, "beta": 154.628, "gamma": 77.466, "delta": 96.114, "epsilon": -126.688, "zeta": -79.218, "epsilon_zeta": -47.470, "bb_type": "--", "chi": -155.421, "glyco_bond": "anti", "C5prime_xyz": [ -0.715, 8.406, 0.351 ], "P_xyz": [ 1.604, 8.125, -0.883 ], "form": "A", "ssZp": 4.234, "Dp": 4.792, "splay_angle": 22.219, "splay_distance": 3.527, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 159.989, "theta": -128.757, "eta_prime": 166.736, "theta_prime": -136.313, "eta_base": -160.737, "theta_base": -120.974, "v0": 19.344, "v1": -35.868, "v2": 38.139, "v3": -27.883, "v4": 5.430, "amplitude": 38.797, "phase_angle": 349.432, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 2.181, -5.698, -9.902 ], "x_axis": [ -0.710, 0.013, 0.704 ], "y_axis": [ -0.690, -0.212, -0.692 ], "z_axis": [ 0.140, -0.977, 0.159 ], "quaternion": [ 0.244, 0.293, -0.579, 0.721 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -92.598, "beta": 153.732, "gamma": 77.501, "delta": 89.918, "epsilon": -143.499, "zeta": -97.319, "epsilon_zeta": -46.180, "bb_type": "BI", "chi": -169.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.566, 1.170 ], "P_xyz": [ 1.100, 9.052, 0.518 ], "form": ".", "ssZp": 4.594, "Dp": 4.615, "splay_angle": 29.790, "splay_distance": 4.536, "splay_ratio": 0.257, "d22": null, "d64": null, "eta": 154.624, "theta": -161.111, "eta_prime": 174.533, "theta_prime": -162.051, "eta_base": -146.374, "theta_base": -147.510, "v0": 4.797, "v1": -25.918, "v2": 36.073, "v3": -34.323, "v4": 18.553, "amplitude": 36.784, "phase_angle": 11.288, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.024, "filter_rmsd": 0.036, "frame": { "rmsd": 0.018, "origin": [ 2.102, -8.714, -8.075 ], "x_axis": [ -0.931, 0.341, 0.131 ], "y_axis": [ -0.240, -0.301, -0.923 ], "z_axis": [ -0.275, -0.890, 0.363 ], "quaternion": [ 0.180, -0.045, -0.563, 0.805 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.851, "beta": 153.548, "gamma": 74.122, "delta": 92.801, "epsilon": -139.704, "zeta": -60.677, "epsilon_zeta": -79.028, "bb_type": "BI", "chi": -167.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.228, 8.498, 1.087 ], "P_xyz": [ 1.334, 8.704, 0.476 ], "form": "A", "ssZp": 4.536, "Dp": 4.625, "splay_angle": 24.251, "splay_distance": 4.013, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 179.037, "theta": -117.677, "eta_prime": -171.112, "theta_prime": -122.423, "eta_base": -147.333, "theta_base": -88.273, "v0": 8.376, "v1": -27.194, "v2": 34.751, "v3": -30.869, "v4": 14.153, "amplitude": 34.886, "phase_angle": 5.051, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.134, "filter_rmsd": 0.036, "frame": { "rmsd": 0.018, "origin": [ 2.293, -12.173, -5.146 ], "x_axis": [ -0.971, 0.106, -0.212 ], "y_axis": [ 0.154, -0.402, -0.903 ], "z_axis": [ -0.181, -0.909, 0.375 ], "quaternion": [ -0.014, -0.119, -0.546, 0.829 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.288, "beta": 179.198, "gamma": 47.061, "delta": 90.258, "epsilon": -157.594, "zeta": -85.059, "epsilon_zeta": -72.535, "bb_type": "BI", "chi": -154.971, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.906, 0.283 ], "P_xyz": [ 0.822, 9.698, 0.841 ], "form": ".", "ssZp": 4.147, "Dp": 4.318, "splay_angle": 28.698, "splay_distance": 4.589, "splay_ratio": 0.248, "d22": 5.260, "d64": 5.337, "eta": 157.834, "theta": -158.707, "eta_prime": -178.446, "theta_prime": -154.889, "eta_base": -120.529, "theta_base": -128.380, "v0": -5.306, "v1": -16.062, "v2": 29.884, "v3": -33.956, "v4": 24.732, "amplitude": 33.699, "phase_angle": 27.526, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.502, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -1.020, -14.260, -4.268 ], "x_axis": [ -0.446, 0.094, -0.890 ], "y_axis": [ 0.769, -0.468, -0.435 ], "z_axis": [ -0.458, -0.878, 0.136 ], "quaternion": [ -0.236, -0.471, -0.458, 0.716 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///A/24", "linked_nts": [ "///A/23", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -80.174, "beta": 164.036, "gamma": 76.647, "delta": 86.815, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -154.972, "glyco_bond": "anti", "C5prime_xyz": [ -1.289, 8.765, 0.339 ], "P_xyz": [ 1.230, 9.092, -0.375 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.289, "v1": -23.708, "v2": 33.778, "v3": -32.857, "v4": 18.740, "amplitude": 34.710, "phase_angle": 13.313, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.178, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -3.756, -17.787, -3.201 ], "x_axis": [ -0.065, -0.253, -0.965 ], "y_axis": [ 0.895, -0.442, 0.056 ], "z_axis": [ -0.441, -0.860, 0.256 ], "quaternion": [ -0.433, -0.529, -0.303, 0.664 ] } } ], "num_hbonds": 47, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 753, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/1/O6", "atom2_id": "///A/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 16, "atom2_serNum": 751, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/1/N1", "atom2_id": "///A/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 750, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/1/N2", "atom2_id": "///A/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 49, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/2/O6", "atom2_id": "///A/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 50, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/2/N1", "atom2_id": "///A/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 52, "atom2_serNum": 719, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/2/N2", "atom2_id": "///A/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 76, "atom2_serNum": 99, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///A/3/O2'", "atom2_id": "///A/4/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 76, "atom2_serNum": 102, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///A/3/O2'", "atom2_id": "///A/4/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 81, "atom2_serNum": 690, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/3/N3", "atom2_id": "///A/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 83, "atom2_serNum": 689, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/3/O4", "atom2_id": "///A/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 111, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/4/N3", "atom2_id": "///A/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 113, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/4/O4", "atom2_id": "///A/21/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 140, "atom2_serNum": 625, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/5/O2", "atom2_id": "///A/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 141, "atom2_serNum": 623, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/5/N3", "atom2_id": "///A/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 143, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/5/N4", "atom2_id": "///A/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 171, "atom2_serNum": 560, "donAcc_type": "questionable", "distance": 2.432, "atom1_id": "///A/6/O2", "atom2_id": "///A/18/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 171, "atom2_serNum": 592, "donAcc_type": "standard", "distance": 3.968, "atom1_id": "///A/6/O2", "atom2_id": "///A/19/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 172, "atom2_serNum": 559, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/6/N3", "atom2_id": "///A/18/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 198, "atom2_serNum": 225, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///A/7/O2'", "atom2_id": "///A/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 202, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/7/O2", "atom2_id": "///A/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 203, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/7/N3", "atom2_id": "///A/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 205, "atom2_serNum": 525, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/7/N4", "atom2_id": "///A/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 229, "atom2_serNum": 253, "donAcc_type": "acceptable", "distance": 2.517, "atom1_id": "///A/8/O2'", "atom2_id": "///A/9/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 233, "atom2_serNum": 494, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/8/O2", "atom2_id": "///A/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 234, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/8/N3", "atom2_id": "///A/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 236, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/8/N4", "atom2_id": "///A/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 265, "atom2_serNum": 459, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/9/N3", "atom2_id": "///A/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 267, "atom2_serNum": 458, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/9/O4", "atom2_id": "///A/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 290, "atom2_serNum": 425, "donAcc_type": "acceptable", "distance": 3.262, "atom1_id": "///A/10/O2'", "atom2_id": "///A/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 300, "atom2_serNum": 347, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/10/N2", "atom2_id": "///A/12/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 300, "atom2_serNum": 422, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/10/N2", "atom2_id": "///A/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 301, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///A/10/N3", "atom2_id": "///A/14/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 324, "atom2_serNum": 347, "donAcc_type": "acceptable", "distance": 2.551, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 324, "atom2_serNum": 348, "donAcc_type": "acceptable", "distance": 2.219, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 324, "atom2_serNum": 351, "donAcc_type": "acceptable", "distance": 2.273, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 347, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///A/12/OP2", "atom2_id": "///A/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 355, "atom2_serNum": 414, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///A/12/O2'", "atom2_id": "///A/14/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 388, "atom2_serNum": 392, "donAcc_type": "acceptable", "distance": 2.447, "atom1_id": "///A/13/O2'", "atom2_id": "///A/13/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 418, "atom2_serNum": 447, "donAcc_type": "acceptable", "distance": 2.496, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 484, "atom2_serNum": 511, "donAcc_type": "acceptable", "distance": 2.311, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 484, "atom2_serNum": 514, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 552, "atom2_serNum": 578, "donAcc_type": "acceptable", "distance": 2.494, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 552, "atom2_serNum": 581, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 575, "atom2_serNum": 611, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///A/19/O2'", "atom2_id": "///A/20/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 649, "atom2_serNum": 678, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 715, "atom2_serNum": 739, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///A/23/O2'", "atom2_id": "///A/24/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 715, "atom2_serNum": 742, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/23/O2'", "atom2_id": "///A/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "https://x3dna.org/", "web_dssr": "https://web.x3dna-dssr.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1nz1", "num_naChains": 1, "naChains": "A=24", "num_atoms": 767, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 16, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 13, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 14, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }