**************************************************************************** File name: 4da3.pdb no. of DNA/RNA chains: 1 [A=21] no. of nucleotides: 21 no. of atoms: 532 no. of waters: 25 no. of metals: 3 [K=3] **************************************************************************** List of 12 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.DG1 A.DG7 G+G -- 06-VI cWH cW+M 2 A.DG1 A.DG19 G+G -- 06-VI cHW cM+W 3 A.DG2 A.DG8 G+G -- 06-VI cWH cW+M 4 A.DG2 A.DG20 G+G -- 06-VI cHW cM+W 5 A.DG3 A.DG9 G+G -- 06-VI cWH cW+M 6 A.DG3 A.DG21 G+G -- 06-VI cHW cM+W 7 A.DG7 A.DG13 G+G -- 06-VI cWH cW+M 8 A.DG8 A.DG14 G+G -- 06-VI cWH cW+M 9 A.DG9 A.DG15 G+G -- 06-VI cWH cW+M 10 A.DG13 A.DG19 G+G -- 06-VI cWH cW+M 11 A.DG14 A.DG20 G+G -- 06-VI cWH cW+M 12 A.DG15 A.DG21 G+G -- 06-VI cWH cW+M **************************************************************************** List of 3 multiplets 1 nts=4 GGGG A.DG1,A.DG7,A.DG13,A.DG19 2 nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20 3 nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 A.DG1 A.DG7 G+G -- 06-VI cWH cW+M 2 A.DG2 A.DG8 G+G -- 06-VI cWH cW+M 3 A.DG3 A.DG9 G+G -- 06-VI cWH cW+M -------------------------------------------------------------------------- helix#2[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 A.DG13 A.DG19 G+G -- 06-VI cWH cW+M 2 A.DG14 A.DG20 G+G -- 06-VI cWH cW+M 3 A.DG15 A.DG21 G+G -- 06-VI cWH cW+M **************************************************************************** List of 7 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 TA A.DT4,A.DA6 2 nts=2 TA A.DT11,A.DA12 3 nts=2 TA A.DT17,A.DA18 4 nts=3 GGG A.DG1,A.DG2,A.DG3 5 nts=3 GGG A.DG7,A.DG8,A.DG9 6 nts=3 GGG A.DG13,A.DG14,A.DG15 7 nts=3 GGG A.DG19,A.DG20,A.DG21 **************************************************************************** Nucleotides not involved in stacking interactions nts=2 TT A.DT10,A.DT16 **************************************************************************** List of 2 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 other NBM@A.0DX104 A.DG3 3.28 2 other NBN@A.0DX104 A.DG9 3.25 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=21 GGGTTAGGGTTAGGGTTAGGG A.DG1,A.DG2,A.DG3,A.DT4,A.DT5,A.DA6,A.DG7,A.DG8,A.DG9,A.DT10,A.DT11,A.DA12,A.DG13,A.DG14,A.DG15,A.DT16,A.DT17,A.DA18,A.DG19,A.DG20,A.DG21 **************************************************************************** List of 3 G-tetrads 1 glyco-bond=---- sugar=3--- groove=---- planarity=0.201 type=other nts=4 GGGG A.DG1,A.DG7,A.DG13,A.DG19 2 glyco-bond=---- sugar=3-3- groove=---- planarity=0.095 type=planar nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20 3 glyco-bond=---- sugar=---- groove=---- planarity=0.337 type=bowl nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 **************************************************************************** List of 1 G4-helix Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem. helix#1[1] stems=[#1] layers=3 INTRA-molecular 1 glyco-bond=---- sugar=3--- groove=---- WC-->Major nts=4 GGGG A.DG1,A.DG7,A.DG13,A.DG19 2 glyco-bond=---- sugar=3-3- groove=---- WC-->Major nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20 3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 step#1 pm(>>,forward) area=8.98 rise=3.31 twist=33.5 step#2 pm(>>,forward) area=14.14 rise=3.61 twist=23.7 strand#1 DNA glyco-bond=--- sugar=33- nts=3 GGG A.DG1,A.DG2,A.DG3 strand#2 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG7,A.DG8,A.DG9 strand#3 DNA glyco-bond=--- sugar=-3- nts=3 GGG A.DG13,A.DG14,A.DG15 strand#4 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG19,A.DG20,A.DG21 **************************************************************************** List of 1 G4-stem Note: a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands. stem#1[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-P-P-P) note=4+0 UUUU parallel 1 glyco-bond=---- sugar=3--- groove=---- WC-->Major nts=4 GGGG A.DG1,A.DG7,A.DG13,A.DG19 2 glyco-bond=---- sugar=3-3- groove=---- WC-->Major nts=4 GGGG A.DG2,A.DG8,A.DG14,A.DG20 3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 step#1 pm(>>,forward) area=8.98 rise=3.31 twist=33.5 step#2 pm(>>,forward) area=14.14 rise=3.61 twist=23.7 strand#1 U DNA glyco-bond=--- sugar=33- nts=3 GGG A.DG1,A.DG2,A.DG3 strand#2 U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG7,A.DG8,A.DG9 strand#3 U DNA glyco-bond=--- sugar=-3- nts=3 GGG A.DG13,A.DG14,A.DG15 strand#4 U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG19,A.DG20,A.DG21 loop#1 type=propeller strands=[#1,#2] nts=3 TTA A.DT4,A.DT5,A.DA6 loop#2 type=propeller strands=[#2,#3] nts=3 TTA A.DT10,A.DT11,A.DA12 loop#3 type=propeller strands=[#3,#4] nts=3 TTA A.DT16,A.DT17,A.DA18 **************************************************************************** List of 6 splayed-apart dinucleotides 1 A.DA6 A.DG7 angle=90 distance=15.4 ratio=0.71 2 A.DG9 A.DT10 angle=123 distance=14.6 ratio=0.88 3 A.DT10 A.DT11 angle=158 distance=19.1 ratio=0.98 4 A.DA12 A.DG13 angle=112 distance=18.0 ratio=0.83 5 A.DG15 A.DT16 angle=151 distance=18.6 ratio=0.97 6 A.DA18 A.DG19 angle=153 distance=18.9 ratio=0.97 ---------------------------------------------------------------- Summary of 5 splayed-apart units 1 nts=2 AG A.DA6,A.DG7 2 nts=3 GTT A.DG9,A.DT10,A.DT11 3 nts=2 AG A.DA12,A.DG13 4 nts=2 GT A.DG15,A.DT16 5 nts=2 AG A.DA18,A.DG19 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >4da3 nts=21 [whole] GGGTTAGGGTTAGGGTTAGGG ..................... >4da3-A #1 nts=21 0.22(3.61) [chain] DNA GGGTTAGGGTTAGGGTTAGGG ..................... **************************************************************************** Summary of structural features of 21 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G . A.DG1 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 2 G . A.DG2 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 3 G . A.DG3 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor,phosphate 4 T . A.DT4 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop 5 T . A.DT5 0.003 turn,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 6 A . A.DA6 0.004 anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 7 G . A.DG7 0.007 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 8 G . A.DG8 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 9 G . A.DG9 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor,splayed-apart 10 T . A.DT10 0.002 syn,~C2'-endo,non-stack,ss-non-loop,splayed-apart 11 T . A.DT11 0.008 anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 12 A . A.DA12 0.006 anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 13 G . A.DG13 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 14 G . A.DG14 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 15 G . A.DG15 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 16 T . A.DT16 0.002 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 17 T . A.DT17 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop 18 A . A.DA18 0.003 ~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart 19 G . A.DG19 0.004 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 20 G . A.DG20 0.010 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 21 G . A.DG21 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad **************************************************************************** List of 14 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 11 dssr-rotmat.txt -- position vector and rotation matrix 12 dssr-viewV.pdb -- vertical view of the principal moment of inertia 13 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 14 dssr-viewT.pdb -- top view of the principal moment of inertia