{ "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -113.875, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.463, "chi2": -128.990, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.472, "C1C1_dist": 10.791, "N1N9_dist": 9.043, "C6C8_dist": 9.942, "CNNC_torsion": 3.936, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 2.837, "planarity": 0.069, "simple_Shear": -0.462, "simple_Stretch": -0.099, "simple_Buckle": 2.619, "simple_Propeller": -1.090, "bp_simpleParams": [ -0.462, -0.099, -0.168, 2.619, -1.090, -1.060 ], "bp_params": [ -0.457, -0.118, -0.168, 2.662, -0.981, -1.060 ], "frame": { "rmsd": null, "origin": [ 22.411, 39.444, 20.895 ], "x_axis": [ 0.478, 0.666, 0.573 ], "y_axis": [ -0.732, -0.059, 0.679 ], "z_axis": [ 0.486, -0.744, 0.459 ], "quaternion": [ 0.685, 0.519, -0.032, 0.510 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -107.512, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.039, "chi2": -115.508, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.555, "C1C1_dist": 10.697, "N1N9_dist": 8.985, "C6C8_dist": 9.903, "CNNC_torsion": -3.935, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 5.238, "planarity": 0.068, "simple_Shear": 0.578, "simple_Stretch": -0.134, "simple_Buckle": 2.632, "simple_Propeller": -4.529, "bp_simpleParams": [ 0.578, -0.134, -0.171, 2.632, -4.529, -0.258 ], "bp_params": [ 0.571, -0.164, -0.171, 2.390, -4.661, -0.258 ], "frame": { "rmsd": null, "origin": [ 24.644, 36.785, 21.685 ], "x_axis": [ -0.086, 0.491, 0.867 ], "y_axis": [ -0.879, -0.446, 0.166 ], "z_axis": [ 0.468, -0.748, 0.470 ], "quaternion": [ 0.484, 0.472, -0.206, 0.707 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -97.644, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.846, "chi2": -86.341, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.948, "C1C1_dist": 10.432, "N1N9_dist": 8.862, "C6C8_dist": 9.820, "CNNC_torsion": -20.738, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 25.850, "planarity": 0.303, "simple_Shear": -0.637, "simple_Stretch": -0.058, "simple_Buckle": -21.681, "simple_Propeller": -14.077, "bp_simpleParams": [ -0.637, -0.058, -0.353, -21.681, -14.077, 2.328 ], "bp_params": [ -0.634, -0.089, -0.353, -21.020, -15.046, 2.309 ], "frame": { "rmsd": null, "origin": [ 26.144, 34.032, 23.979 ], "x_axis": [ -0.685, 0.168, 0.709 ], "y_axis": [ -0.568, -0.733, -0.375 ], "z_axis": [ 0.456, -0.660, 0.597 ], "quaternion": [ 0.212, 0.336, -0.298, 0.868 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -111.422, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 56.624, "chi2": -89.515, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.849, "C1C1_dist": 10.624, "N1N9_dist": 8.991, "C6C8_dist": 9.982, "CNNC_torsion": -3.613, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 9.495, "planarity": 0.164, "simple_Shear": -0.000, "simple_Stretch": -0.015, "simple_Buckle": -6.671, "simple_Propeller": -6.758, "bp_simpleParams": [ -0.000, -0.015, -0.375, -6.671, -6.758, 1.157 ], "bp_params": [ -0.000, -0.015, -0.375, -6.643, -6.785, 1.157 ], "frame": { "rmsd": null, "origin": [ 26.615, 31.255, 25.411 ], "x_axis": [ -0.910, -0.198, 0.364 ], "y_axis": [ -0.131, -0.695, -0.707 ], "z_axis": [ 0.393, -0.691, 0.607 ], "quaternion": [ -0.019, 0.211, -0.390, 0.896 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/13", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 62.340, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 64.885, "chi2": -129.271, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.745, "C1C1_dist": 11.698, "N1N9_dist": 9.771, "C6C8_dist": 9.487, "CNNC_torsion": -8.737, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.85],N2(amino)-N7[2.91]", "interBase_angle": 6.835, "planarity": 0.110, "simple_Shear": -2.316, "simple_Stretch": 2.983, "simple_Buckle": 1.327, "simple_Propeller": -6.705, "bp_simpleParams": [ -2.316, 2.983, 0.512, 1.327, -6.705, -88.157 ], "bp_params": [ 2.048, 3.173, 0.512, -5.888, -3.472, -88.107 ], "frame": { "rmsd": null, "origin": [ 24.958, 25.690, 25.119 ], "x_axis": [ 0.453, 0.668, 0.590 ], "y_axis": [ 0.835, -0.088, -0.543 ], "z_axis": [ -0.311, 0.739, -0.598 ], "quaternion": [ -0.438, 0.731, 0.514, 0.095 ] } }, { "index": 6, "nt1": "///A/5", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 62.340, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 26.421, "chi2": -111.463, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 65.861, "C1C1_dist": 11.681, "N1N9_dist": 9.773, "C6C8_dist": 9.473, "CNNC_torsion": 1.825, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.95],O6(carbonyl)-N1(imino)[2.85]", "interBase_angle": 2.339, "planarity": 0.101, "simple_Shear": -2.413, "simple_Stretch": 2.825, "simple_Buckle": -2.336, "simple_Propeller": 0.128, "bp_simpleParams": [ -2.413, 2.825, 0.463, -2.336, 0.128, 90.579 ], "bp_params": [ -1.847, -3.224, 0.463, 0.667, -2.242, 90.589 ], "frame": { "rmsd": null, "origin": [ 26.695, 27.470, 26.262 ], "x_axis": [ -0.840, 0.119, 0.530 ], "y_axis": [ 0.456, 0.684, 0.569 ], "z_axis": [ -0.295, 0.719, -0.629 ], "quaternion": [ -0.232, 0.162, 0.888, 0.363 ] } }, { "index": 7, "nt1": "///A/6", "nt2": "///A/12", "bp": "g+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 58.232, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 61.526, "chi2": -164.562, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 28.194, "C1C1_dist": 11.602, "N1N9_dist": 9.609, "C6C8_dist": 9.203, "CNNC_torsion": -0.095, "hbonds_num": 2, "hbonds_desc": "N2(amino)-N7[2.93],N1(imino)-O6(carbonyl)[2.99]", "interBase_angle": 8.816, "planarity": 0.139, "simple_Shear": -2.762, "simple_Stretch": 2.793, "simple_Buckle": -7.494, "simple_Propeller": -4.644, "bp_simpleParams": [ -2.762, 2.793, 0.260, -7.494, -4.644, -89.369 ], "bp_params": [ 1.499, 3.630, 0.260, -7.190, 5.102, -89.313 ], "frame": { "rmsd": null, "origin": [ 27.068, 23.389, 26.554 ], "x_axis": [ -0.052, 0.667, 0.744 ], "y_axis": [ 0.955, 0.252, -0.159 ], "z_axis": [ -0.293, 0.702, -0.649 ], "quaternion": [ -0.371, 0.580, 0.699, 0.194 ] } }, { "index": 8, "nt1": "///A/6", "nt2": "///A/20", "bp": "g+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 58.232, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 28.094, "chi2": -96.791, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 65.276, "C1C1_dist": 11.577, "N1N9_dist": 9.675, "C6C8_dist": 9.319, "CNNC_torsion": 19.968, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.93],O6(carbonyl)-N1(imino)[2.96]", "interBase_angle": 6.499, "planarity": 0.144, "simple_Shear": -2.574, "simple_Stretch": 2.829, "simple_Buckle": -4.828, "simple_Propeller": 4.350, "bp_simpleParams": [ -2.574, 2.829, 0.670, -4.828, 4.350, 89.274 ], "bp_params": [ -1.695, -3.429, 0.670, -2.289, -6.082, 89.343 ], "frame": { "rmsd": null, "origin": [ 27.950, 25.111, 28.386 ], "x_axis": [ -0.958, -0.238, 0.162 ], "y_axis": [ -0.034, 0.652, 0.758 ], "z_axis": [ -0.285, 0.720, -0.632 ], "quaternion": [ -0.124, -0.075, 0.900, 0.411 ] } }, { "index": 9, "nt1": "///A/7", "nt2": "///A/11", "bp": "g+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 67.643, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 63.044, "chi2": -94.501, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 24.677, "C1C1_dist": 11.679, "N1N9_dist": 9.687, "C6C8_dist": 9.382, "CNNC_torsion": -3.516, "hbonds_num": 2, "hbonds_desc": "N2(amino)-N7[2.96],N1(imino)-O6(carbonyl)[2.83]", "interBase_angle": 24.700, "planarity": 0.342, "simple_Shear": -2.546, "simple_Stretch": 2.717, "simple_Buckle": -11.291, "simple_Propeller": -21.968, "bp_simpleParams": [ -2.546, 2.717, 0.582, -11.291, -21.968, -92.479 ], "bp_params": [ 1.651, 3.337, 0.582, -24.544, 2.776, -91.172 ], "frame": { "rmsd": null, "origin": [ 29.107, 21.646, 28.698 ], "x_axis": [ -0.399, 0.538, 0.742 ], "y_axis": [ 0.885, 0.438, 0.158 ], "z_axis": [ -0.240, 0.720, -0.651 ], "quaternion": [ -0.311, 0.451, 0.789, 0.278 ] } }, { "index": 10, "nt1": "///A/7", "nt2": "///A/19", "bp": "g+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 67.643, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 33.415, "chi2": -125.202, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 65.033, "C1C1_dist": 11.440, "N1N9_dist": 9.606, "C6C8_dist": 9.313, "CNNC_torsion": 36.099, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.95],O6(carbonyl)-N1(imino)[3.00]", "interBase_angle": 15.131, "planarity": 0.276, "simple_Shear": -2.533, "simple_Stretch": 2.808, "simple_Buckle": -15.103, "simple_Propeller": -0.919, "bp_simpleParams": [ -2.533, 2.808, 0.928, -15.103, -0.919, 88.386 ], "bp_params": [ -1.709, -3.373, 0.928, 6.284, -13.765, 88.714 ], "frame": { "rmsd": null, "origin": [ 28.845, 23.147, 30.795 ], "x_axis": [ -0.902, -0.370, -0.221 ], "y_axis": [ -0.388, 0.476, 0.789 ], "z_axis": [ -0.187, 0.798, -0.573 ], "quaternion": [ 0.010, -0.221, 0.859, 0.462 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///A/15", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -94.501, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 67.158, "chi2": -149.412, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 28.425, "C1C1_dist": 11.529, "N1N9_dist": 9.677, "C6C8_dist": 9.370, "CNNC_torsion": 15.231, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.87],N2(amino)-N7[2.90]", "interBase_angle": 8.933, "planarity": 0.134, "simple_Shear": -2.422, "simple_Stretch": 2.958, "simple_Buckle": -1.923, "simple_Propeller": -8.724, "bp_simpleParams": [ -2.422, 2.958, -0.113, -1.923, -8.724, -87.105 ], "bp_params": [ 1.924, 3.304, -0.113, -8.845, -1.254, -86.938 ], "frame": { "rmsd": null, "origin": [ 26.583, 20.558, 29.226 ], "x_axis": [ 0.812, 0.582, 0.034 ], "y_axis": [ 0.388, -0.497, -0.777 ], "z_axis": [ -0.435, 0.644, -0.629 ], "quaternion": [ -0.414, 0.857, 0.283, -0.117 ] } }, { "index": 12, "nt1": "///A/12", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -164.562, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.681, "chi2": -105.419, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.996, "C1C1_dist": 11.674, "N1N9_dist": 9.688, "C6C8_dist": 9.315, "CNNC_torsion": -11.864, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.90],N2(amino)-N7[2.94]", "interBase_angle": 8.378, "planarity": 0.118, "simple_Shear": -2.643, "simple_Stretch": 2.765, "simple_Buckle": -2.263, "simple_Propeller": -8.067, "bp_simpleParams": [ -2.643, 2.765, 0.351, -2.263, -8.067, -90.810 ], "bp_params": [ 1.592, 3.478, 0.351, -8.331, -0.882, -90.660 ], "frame": { "rmsd": null, "origin": [ 24.656, 23.113, 27.957 ], "x_axis": [ 0.937, 0.289, -0.195 ], "y_axis": [ 0.041, -0.647, -0.761 ], "z_axis": [ -0.347, 0.705, -0.619 ], "quaternion": [ -0.410, 0.895, 0.092, -0.151 ] } }, { "index": 13, "nt1": "///A/13", "nt2": "///A/17", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -129.271, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.388, "chi2": -115.230, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.214, "C1C1_dist": 11.794, "N1N9_dist": 9.795, "C6C8_dist": 9.460, "CNNC_torsion": 6.416, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.90],N2(amino)-N7[2.98]", "interBase_angle": 3.890, "planarity": 0.073, "simple_Shear": -2.520, "simple_Stretch": 2.852, "simple_Buckle": -2.534, "simple_Propeller": 2.952, "bp_simpleParams": [ -2.520, 2.852, -0.351, -2.534, 2.952, -90.722 ], "bp_params": [ 1.784, 3.361, -0.351, 1.873, 3.410, -90.740 ], "frame": { "rmsd": null, "origin": [ 23.212, 26.212, 26.968 ], "x_axis": [ 0.813, -0.020, -0.582 ], "y_axis": [ -0.449, -0.658, -0.604 ], "z_axis": [ -0.371, 0.753, -0.544 ], "quaternion": [ -0.391, 0.868, -0.135, -0.275 ] } }, { "index": 14, "nt1": "///A/15", "nt2": "///A/19", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -149.412, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.455, "chi2": -125.202, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 27.324, "C1C1_dist": 11.680, "N1N9_dist": 9.701, "C6C8_dist": 9.346, "CNNC_torsion": 11.239, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.89],N2(amino)-N7[2.96]", "interBase_angle": 9.492, "planarity": 0.131, "simple_Shear": -2.619, "simple_Stretch": 2.763, "simple_Buckle": -3.395, "simple_Propeller": -8.864, "bp_simpleParams": [ -2.619, 2.763, 0.141, -3.395, -8.864, -90.960 ], "bp_params": [ 1.616, 3.448, 0.141, -9.491, -0.082, -90.764 ], "frame": { "rmsd": null, "origin": [ 26.321, 22.059, 31.322 ], "x_axis": [ 0.370, -0.434, -0.821 ], "y_axis": [ -0.845, -0.525, -0.103 ], "z_axis": [ -0.386, 0.732, -0.561 ], "quaternion": [ -0.267, 0.784, -0.408, -0.385 ] } }, { "index": 15, "nt1": "///A/16", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -105.419, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.954, "chi2": -96.791, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.466, "C1C1_dist": 11.587, "N1N9_dist": 9.615, "C6C8_dist": 9.229, "CNNC_torsion": -10.236, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.90],N2(amino)-N7[2.92]", "interBase_angle": 5.454, "planarity": 0.086, "simple_Shear": -2.686, "simple_Stretch": 2.715, "simple_Buckle": 4.953, "simple_Propeller": -2.285, "bp_simpleParams": [ -2.686, 2.715, 0.028, 4.953, -2.285, -90.431 ], "bp_params": [ 1.506, 3.510, 0.028, -0.255, -5.448, -90.495 ], "frame": { "rmsd": null, "origin": [ 25.538, 24.835, 29.789 ], "x_axis": [ 0.023, -0.632, -0.774 ], "y_axis": [ -0.941, -0.276, 0.198 ], "z_axis": [ -0.339, 0.724, -0.601 ], "quaternion": [ -0.191, 0.689, -0.571, -0.404 ] } }, { "index": 16, "nt1": "///A/17", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -115.230, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 65.066, "chi2": -111.463, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 23.436, "C1C1_dist": 11.792, "N1N9_dist": 9.842, "C6C8_dist": 9.572, "CNNC_torsion": 3.696, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.84],N2(amino)-N7[3.01]", "interBase_angle": 7.095, "planarity": 0.087, "simple_Shear": -2.364, "simple_Stretch": 2.900, "simple_Buckle": -1.510, "simple_Propeller": -6.932, "bp_simpleParams": [ -2.364, 2.900, 0.150, -1.510, -6.932, -90.845 ], "bp_params": [ 1.958, 3.188, 0.150, -7.043, -0.862, -90.738 ], "frame": { "rmsd": null, "origin": [ 24.950, 27.992, 28.111 ], "x_axis": [ -0.450, -0.676, -0.583 ], "y_axis": [ -0.819, 0.052, 0.572 ], "z_axis": [ -0.356, 0.735, -0.577 ], "quaternion": [ 0.079, -0.518, 0.721, 0.453 ] } } ], "num_multiplets": 3, "multiplets": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/5,///A/13,///A/17,///A/21", "planarity": 0.108 }, { "index": 2, "num_nts": 4, "nts_short": "gGGG", "nts_long": "///A/6,///A/12,///A/16,///A/20", "planarity": 0.139 }, { "index": 3, "num_nts": 4, "nts_short": "gGGG", "nts_long": "///A/7,///A/11,///A/15,///A/19", "planarity": 0.284 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GCGTGgg", "strand2": "CGCAGGG", "bp_type": "||||...", "helix_form": ".BB...", "helical_rise": 3.343, "helical_rise_std": 0.352, "helical_radius": 10.191, "helical_radius_std": 1.540, "helical_axis": [ 0.381, -0.795, 0.472 ], "point1": [ 22.122, 38.768, 20.700 ], "point2": [ 29.796, 22.757, 30.200 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.457, -0.118, -0.168, 2.662, -0.981, -1.060 ], "step_params": [ -0.549, -0.842, 3.417, -1.232, 0.138, 38.498 ], "heli_params": [ -1.294, 0.673, 3.429, 0.209, 1.868, 38.517 ], "bp2_params": [ 0.571, -0.164, -0.171, 2.390, -4.661, -0.258 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.417, "simple_Twist": 32.703, "simple_hRise": 3.431, "simple_hTwist": 32.726 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.571, -0.164, -0.171, 2.390, -4.661, -0.258 ], "step_params": [ 0.300, 0.215, 3.866, 3.498, 8.195, 40.148 ], "heli_params": [ -0.756, 0.026, 3.847, 11.763, -5.021, 41.085 ], "bp2_params": [ -0.634, -0.089, -0.353, -21.020, -15.046, 2.309 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.866, "simple_Twist": 45.796, "simple_hRise": 3.860, "simple_hTwist": 46.609 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.634, -0.089, -0.353, -21.020, -15.046, 2.309 ], "step_params": [ 0.470, 1.060, 2.939, -2.341, 3.339, 31.802 ], "heli_params": [ 1.373, -1.234, 2.991, 6.062, 4.250, 32.056 ], "bp2_params": [ -0.000, -0.015, -0.375, -6.643, -6.785, 1.157 ], "groove_widths": [ 13.704, null, 16.236, null ], "simple_Rise": 2.939, "simple_Twist": 29.253, "simple_hRise": 2.993, "simple_hTwist": 29.530 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.000, -0.015, -0.375, -6.643, -6.785, 1.157 ], "step_params": [ 2.107, -0.459, 3.226, 5.664, 2.002, 159.778 ], "heli_params": [ -0.238, -1.056, 3.243, 1.017, -2.876, 159.807 ], "bp2_params": [ -1.847, -3.224, 0.463, 0.667, -2.242, 90.589 ], "groove_widths": [ 14.854, null, 20.650, null ], "simple_Rise": 3.226, "simple_Twist": 34.679, "simple_hRise": 3.485, "simple_hTwist": 35.180 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.847, -3.224, 0.463, 0.667, -2.242, 90.589 ], "step_params": [ 0.263, 0.107, 3.401, 0.044, -0.574, 30.471 ], "heli_params": [ 0.322, -0.491, 3.399, -1.092, -0.084, 30.477 ], "bp2_params": [ -1.695, -3.429, 0.670, -2.289, -6.082, 89.343 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.401, "simple_Twist": 29.069, "simple_hRise": 3.399, "simple_hTwist": 29.075 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/20", "bp": "g+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.695, -3.429, 0.670, -2.289, -6.082, 89.343 ], "step_params": [ 0.292, 0.618, 3.162, 4.036, -6.850, 22.575 ], "heli_params": [ 3.603, 0.541, 2.861, -16.840, -9.924, 23.917 ], "bp2_params": [ -1.709, -3.373, 0.928, 6.284, -13.765, 88.714 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.162, "simple_Twist": 22.645, "simple_hRise": 2.862, "simple_hTwist": 23.983 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/19", "bp": "g+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W" } ] }, { "index": 2, "num_stems": 0, "strand1": "GGG", "strand2": "GGG", "bp_type": "...", "helix_form": "..", "helical_rise": 1.468, "helical_rise_std": 0.167, "helical_radius": 12.451, "helical_radius_std": 0.822, "helical_axis": [ 0.151, 0.550, -0.822 ], "point1": [ 27.324, 24.781, 31.172 ], "point2": [ 27.745, 26.319, 28.872 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/11", "nt2": "///A/15", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.924, 3.304, -0.113, -8.845, -1.254, -86.938 ], "step_params": [ -0.487, -0.949, 3.274, 1.412, 6.049, 21.808 ], "heli_params": [ -4.515, 1.731, 2.871, 15.585, -3.639, 22.665 ], "bp2_params": [ 1.592, 3.478, 0.351, -8.331, -0.882, -90.660 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 23.295, "simple_hRise": 2.903, "simple_hTwist": 24.098 }, { "index": 2, "nt1": "///A/12", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.592, 3.478, 0.351, -8.331, -0.882, -90.660 ], "step_params": [ -0.513, -1.070, 3.355, 4.559, -2.618, 29.485 ], "heli_params": [ -1.515, 1.962, 3.320, -5.092, -8.868, 29.940 ], "bp2_params": [ 1.784, 3.361, -0.351, 1.873, 3.410, -90.740 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.355, "simple_Twist": 28.377, "simple_hRise": 3.317, "simple_hTwist": 28.850 }, { "index": 3, "nt1": "///A/13", "nt2": "///A/17", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCGT", "strand2": "CGCA", "bp_type": "||||", "helix_form": ".BB", "helical_rise": 3.275, "helical_rise_std": 0.338, "helical_radius": 9.294, "helical_radius_std": 1.247, "helical_axis": [ 0.414, -0.773, 0.481 ], "point1": [ 24.106, 40.009, 20.865 ], "point2": [ 28.146, 32.459, 25.558 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.457, -0.118, -0.168, 2.662, -0.981, -1.060 ], "step_params": [ -0.549, -0.842, 3.417, -1.232, 0.138, 38.498 ], "heli_params": [ -1.294, 0.673, 3.429, 0.209, 1.868, 38.517 ], "bp2_params": [ 0.571, -0.164, -0.171, 2.390, -4.661, -0.258 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.417, "simple_Twist": 32.703, "simple_hRise": 3.431, "simple_hTwist": 32.726 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.571, -0.164, -0.171, 2.390, -4.661, -0.258 ], "step_params": [ 0.300, 0.215, 3.866, 3.498, 8.195, 40.148 ], "heli_params": [ -0.756, 0.026, 3.847, 11.763, -5.021, 41.085 ], "bp2_params": [ -0.634, -0.089, -0.353, -21.020, -15.046, 2.309 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.866, "simple_Twist": 45.796, "simple_hRise": 3.860, "simple_hTwist": 46.609 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.634, -0.089, -0.353, -21.020, -15.046, 2.309 ], "step_params": [ 0.470, 1.060, 2.939, -2.341, 3.339, 31.802 ], "heli_params": [ 1.373, -1.234, 2.991, 6.062, 4.250, 32.056 ], "bp2_params": [ -0.000, -0.015, -0.375, -6.643, -6.785, 1.157 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.939, "simple_Twist": 29.253, "simple_hRise": 2.993, "simple_hTwist": 29.530 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "TC", "nts_long": "///A/8,///A/9" }, { "index": 2, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/11,///A/12,///A/13" }, { "index": 3, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/15,///A/16,///A/17" }, { "index": 4, "num_nts": 4, "nts_short": "GGGA", "nts_long": "///A/19,///A/20,///A/21,///A/22" }, { "index": 5, "num_nts": 5, "nts_short": "TGggA", "nts_long": "///A/4,///A/5,///A/6,///A/7,///A/10" } ], "nonStack": { "num_nts": 2, "nts_short": "TT", "nts_long": "///A/14,///A/18" }, "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 17 ], "stem_indices": [ 1 ], "summary": "[1] 17 [A.4 A.22] 4", "num_nts": 19, "nts_short": "TGggTCAGGGTGGGTGGGA", "nts_long": "///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 17, "nts_short": "GggTCAGGGTGGGTGGG", "nts_long": "///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21" } ] } ], "num_Gtetrads": 3, "Gtetrads": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/5,///A/21,///A/17,///A/13", "planarity": 0.108, "G1G2_simpleParams": [ -2.413, 2.825, 0.463, -2.336, 0.128, 90.579 ], "G2G3_simpleParams": [ -2.364, 2.900, -0.150, -1.510, -6.932, 90.845 ], "G3G4_simpleParams": [ -2.520, 2.852, 0.351, -2.534, 2.952, 90.722 ], "G4G1_simpleParams": [ -2.316, 2.983, -0.512, 1.327, -6.705, 88.157 ], "type": "planar", "direction": "Major-->WC", "ONZ_class": "O+", "glyco_bond": "s---", "sugar_pucker": "----", "groove_type": "w--n", "groove_distPP": [ 20.826, 16.785, 15.940, 7.704 ], "rmsd": 0.213, "frame": { "rmsd": null, "origin": [ 24.987, 26.792, 26.630 ], "x_axis": [ 0.846, 0.509, 0.158 ], "y_axis": [ 0.415, -0.444, -0.794 ], "z_axis": [ -0.334, 0.737, -0.588 ], "quaternion": [ -0.451, 0.848, 0.272, -0.052 ] } }, { "index": 2, "num_nts": 4, "nts_short": "gGGG", "nts_long": "///A/6,///A/20,///A/16,///A/12", "planarity": 0.139, "G1G2_simpleParams": [ -2.574, 2.829, 0.670, -4.828, 4.350, 89.274 ], "G2G3_simpleParams": [ -2.686, 2.715, -0.028, 4.953, -2.285, 90.431 ], "G3G4_simpleParams": [ -2.643, 2.765, -0.351, -2.263, -8.067, 90.810 ], "G4G1_simpleParams": [ -2.762, 2.793, -0.260, -7.494, -4.644, 89.369 ], "type": "planar", "direction": "Major-->WC", "ONZ_class": "O+", "glyco_bond": "s---", "sugar_pucker": "---3", "groove_type": "w--n", "groove_distPP": [ 21.503, 17.159, 17.821, 9.189 ], "rmsd": 0.074, "frame": { "rmsd": null, "origin": [ 26.343, 24.056, 28.234 ], "x_axis": [ 0.545, 0.676, 0.496 ], "y_axis": [ 0.777, -0.184, -0.602 ], "z_axis": [ -0.316, 0.713, -0.626 ], "quaternion": [ -0.429, 0.767, 0.474, 0.059 ] } }, { "index": 3, "num_nts": 4, "nts_short": "gGGG", "nts_long": "///A/7,///A/19,///A/15,///A/11", "planarity": 0.284, "G1G2_simpleParams": [ -2.533, 2.808, 0.928, -15.103, -0.919, 88.386 ], "G2G3_simpleParams": [ -2.619, 2.763, -0.141, -3.395, -8.864, 90.960 ], "G3G4_simpleParams": [ -2.422, 2.958, 0.113, -1.923, -8.724, 87.105 ], "G4G1_simpleParams": [ -2.546, 2.717, -0.582, -11.291, -21.968, 92.479 ], "type": "other", "direction": "Major-->WC", "ONZ_class": "O+", "glyco_bond": "s---", "sugar_pucker": "----", "groove_type": "w--n", "groove_distPP": [ 21.752, 15.774, 14.755, 7.417 ], "rmsd": 0.240, "frame": { "rmsd": null, "origin": [ 27.789, 21.605, 30.189 ], "x_axis": [ 0.197, 0.677, 0.709 ], "y_axis": [ 0.928, 0.104, -0.357 ], "z_axis": [ -0.315, 0.729, -0.608 ], "quaternion": [ -0.416, 0.652, 0.615, 0.151 ] } } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "gT", "nts_long": "///A/7,///A/8" }, { "index": 2, "num_nts": 3, "nts_short": "GTG", "nts_long": "///A/13,///A/14,///A/15" } ], "dbn": { "all_chains": { "num_nts": 25, "num_chars": 25, "bseq": "GCGTGggTCAGGGTGGGTGGGACGC", "bseqUP": "GCGTGGGTCAGGGTGGGTGGGACGC", "sstr": "((((.................))))", "form": "BBB........A.......BBBB.-" }, "m1_chain_A": { "num_nts": 25, "num_chars": 25, "bseq": "GCGTGggTCAGGGTGGGTGGGACGC", "bseqUP": "GCGTGGGTCAGGGTGGGTGGGACGC", "sstr": "((((.................))))", "form": "BBB........A.......BBBB.-" } }, "chains": { "m1_chain_A": { "num_nts": 25, "bseq": "GCGTGggTCAGGGTGGGTGGGACGC", "sstr": "((((.................))))", "form": "BBB........A.......BBBB.-", "helical_rise": 0.356, "helical_rise_std": 2.372, "helical_axis": [ 0.840, 0.459, -0.288 ], "point1": [ 26.398, 22.785, 26.699 ], "point2": [ 34.199, 27.047, 24.021 ], "num_chars": 73, "suite": "G!!C!!G!!T!!G!!g!!g!!T!!C!!A3bG4nG1bG6pT!!G2aG!!G!!T!!G!!G4bG4bA4bC4bG!!C" } }, "num_nts": 25, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -61.635, "delta": 145.398, "epsilon": 168.709, "zeta": -94.933, "epsilon_zeta": -96.358, "bb_type": "BI", "chi": -113.875, "glyco_bond": "anti", "C5prime_xyz": [ -2.054, 8.479, -1.288 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 2.261, "Dp": 2.146, "splay_angle": 21.311, "splay_distance": 3.518, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -16.890, "v1": 33.571, "v2": -35.649, "v3": 27.199, "v4": -6.867, "amplitude": 36.045, "phase_angle": 171.501, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 22.304, 39.357, 20.685 ], "x_axis": [ 0.489, 0.660, 0.570 ], "y_axis": [ -0.716, -0.070, 0.695 ], "z_axis": [ 0.499, -0.748, 0.438 ], "quaternion": [ 0.681, 0.530, -0.026, 0.505 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.698, "beta": -158.451, "gamma": 51.313, "delta": 140.005, "epsilon": 163.691, "zeta": -87.661, "epsilon_zeta": -108.648, "bb_type": "BI", "chi": -107.512, "glyco_bond": "anti", "C5prime_xyz": [ -1.863, 8.269, -1.886 ], "P_xyz": [ 0.275, 9.608, -1.070 ], "form": "B", "ssZp": 1.569, "Dp": 2.015, "splay_angle": 23.253, "splay_distance": 3.784, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 173.231, "theta": -142.569, "eta_prime": -162.172, "theta_prime": -154.725, "eta_base": -114.625, "theta_base": -107.195, "v0": -14.683, "v1": 30.524, "v2": -32.903, "v3": 25.884, "v4": -7.433, "amplitude": 33.129, "phase_angle": 173.303, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.021, "origin": [ 24.652, 37.025, 21.879 ], "x_axis": [ -0.064, 0.462, 0.885 ], "y_axis": [ -0.870, -0.461, 0.177 ], "z_axis": [ 0.489, -0.758, 0.431 ], "quaternion": [ 0.476, 0.491, -0.208, 0.699 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.044, "beta": -155.264, "gamma": 49.456, "delta": 141.371, "epsilon": -167.617, "zeta": -83.008, "epsilon_zeta": -84.609, "bb_type": "BI", "chi": -97.644, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 7.889, -2.380 ], "P_xyz": [ 0.512, 9.263, -1.588 ], "form": "B", "ssZp": 0.735, "Dp": 1.841, "splay_angle": 18.078, "splay_distance": 3.199, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": -174.945, "theta": -116.884, "eta_prime": -156.014, "theta_prime": -133.914, "eta_base": -106.762, "theta_base": -89.393, "v0": -8.809, "v1": 24.783, "v2": -29.816, "v3": 26.103, "v4": -11.131, "amplitude": 29.839, "phase_angle": 182.273, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.036, "origin": [ 26.306, 34.128, 23.665 ], "x_axis": [ -0.640, 0.060, 0.766 ], "y_axis": [ -0.637, -0.600, -0.485 ], "z_axis": [ 0.431, -0.798, 0.422 ], "quaternion": [ 0.213, 0.367, -0.393, 0.816 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -72.839, "beta": 161.614, "gamma": 49.991, "delta": 80.370, "epsilon": 32.685, "zeta": 66.188, "epsilon_zeta": -33.503, "bb_type": "--", "chi": -111.422, "glyco_bond": "anti", "C5prime_xyz": [ -3.321, 8.108, -2.330 ], "P_xyz": [ -1.493, 9.474, -3.673 ], "form": ".", "ssZp": 0.927, "Dp": 1.437, "splay_angle": 29.424, "splay_distance": 5.003, "splay_ratio": 0.270, "d22": null, "d64": null, "eta": -172.838, "theta": -165.810, "eta_prime": -157.169, "theta_prime": -173.617, "eta_base": -112.394, "theta_base": -95.841, "v0": -32.931, "v1": 11.167, "v2": 12.500, "v3": -32.376, "v4": 41.535, "amplitude": 40.329, "phase_angle": 71.945, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.030, "origin": [ 26.543, 31.390, 25.303 ], "x_axis": [ -0.887, -0.246, 0.391 ], "y_axis": [ -0.147, -0.652, -0.744 ], "z_axis": [ 0.438, -0.717, 0.542 ], "quaternion": [ -0.028, 0.236, -0.416, 0.878 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad", "alpha": 75.437, "beta": 173.533, "gamma": -171.717, "delta": 137.964, "epsilon": -177.542, "zeta": -86.312, "epsilon_zeta": -91.230, "bb_type": "BI", "chi": 62.340, "glyco_bond": "syn", "C5prime_xyz": [ -5.529, 4.647, 1.577 ], "P_xyz": [ -6.599, 3.546, 3.733 ], "form": ".", "ssZp": -2.043, "Dp": 2.469, "splay_angle": 21.057, "splay_distance": 3.505, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 169.939, "theta": -174.234, "eta_prime": 178.659, "theta_prime": -173.658, "eta_base": -97.910, "theta_base": -151.149, "v0": -31.633, "v1": 42.742, "v2": -36.479, "v3": 19.633, "v4": 7.205, "amplitude": 41.664, "phase_angle": 151.112, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 26.668, 26.424, 24.710 ], "x_axis": [ -0.272, 0.583, 0.766 ], "y_axis": [ 0.920, 0.390, 0.030 ], "z_axis": [ -0.281, 0.713, -0.643 ], "quaternion": [ -0.345, 0.495, 0.759, 0.245 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "BGM", "nt_code": "g", "is_modified": true, "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": ".", "summary": "modified,syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad", "alpha": -73.345, "beta": -178.762, "gamma": 47.396, "delta": 107.156, "epsilon": -170.186, "zeta": -89.491, "epsilon_zeta": -80.695, "bb_type": "BI", "chi": 58.232, "glyco_bond": "syn", "C5prime_xyz": [ -5.781, 5.426, 1.477 ], "P_xyz": [ -7.526, 3.440, 1.544 ], "form": ".", "ssZp": -2.833, "Dp": 2.771, "splay_angle": 19.716, "splay_distance": 3.335, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 165.021, "theta": -156.254, "eta_prime": -178.170, "theta_prime": -159.417, "eta_base": -143.974, "theta_base": -150.564, "v0": -43.282, "v1": 38.512, "v2": -19.085, "v3": -5.633, "v4": 30.388, "amplitude": 42.775, "phase_angle": 116.499, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 28.724, 24.437, 26.738 ], "x_axis": [ -0.711, 0.306, 0.633 ], "y_axis": [ 0.663, 0.593, 0.458 ], "z_axis": [ -0.235, 0.745, -0.624 ], "quaternion": [ -0.254, 0.283, 0.856, 0.351 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "BGM", "nt_code": "g", "is_modified": true, "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": ".", "summary": "modified,syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,splayed-apart", "alpha": -73.086, "beta": 174.502, "gamma": 48.868, "delta": 115.192, "epsilon": -96.144, "zeta": -68.436, "epsilon_zeta": -27.708, "bb_type": "--", "chi": 67.643, "glyco_bond": "syn", "C5prime_xyz": [ -5.780, 5.537, 1.208 ], "P_xyz": [ -7.296, 3.448, 1.734 ], "form": ".", "ssZp": -2.331, "Dp": 1.632, "splay_angle": 103.765, "splay_distance": 14.962, "splay_ratio": 0.787, "d22": null, "d64": null, "eta": -177.656, "theta": -43.816, "eta_prime": -169.347, "theta_prime": -100.201, "eta_base": -156.612, "theta_base": -146.416, "v0": -41.925, "v1": 38.714, "v2": -20.615, "v3": -3.136, "v4": 28.041, "amplitude": 41.772, "phase_angle": 119.571, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ 30.184, 23.031, 29.386 ], "x_axis": [ -0.932, 0.168, 0.322 ], "y_axis": [ 0.359, 0.563, 0.745 ], "z_axis": [ -0.056, 0.809, -0.584 ], "quaternion": [ -0.108, 0.150, 0.877, 0.443 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 146.207, "beta": 167.561, "gamma": 57.946, "delta": 146.012, "epsilon": -157.842, "zeta": -78.259, "epsilon_zeta": -79.582, "bb_type": "BI", "chi": -101.386, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 8.073, -2.119 ], "P_xyz": [ 0.488, 8.757, -1.963 ], "form": ".", "ssZp": 1.336, "Dp": 1.860, "splay_angle": 18.348, "splay_distance": 3.250, "splay_ratio": 0.161, "d22": 3.916, "d64": 3.682, "eta": -19.355, "theta": -94.811, "eta_prime": 65.071, "theta_prime": -121.839, "eta_base": 59.337, "theta_base": -102.654, "v0": -14.657, "v1": 30.483, "v2": -33.233, "v3": 26.319, "v4": -7.530, "amplitude": 33.435, "phase_angle": 173.700, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.097, "frame": { "rmsd": 0.030, "origin": [ 38.398, 18.181, 40.912 ], "x_axis": [ -0.382, 0.716, 0.584 ], "y_axis": [ -0.143, 0.579, -0.803 ], "z_axis": [ -0.913, -0.391, -0.119 ], "quaternion": [ 0.519, -0.199, -0.721, 0.414 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop", "alpha": -81.119, "beta": 165.032, "gamma": 47.238, "delta": 115.189, "epsilon": -76.854, "zeta": -67.734, "epsilon_zeta": -9.120, "bb_type": "--", "chi": -82.706, "glyco_bond": "anti", "C5prime_xyz": [ -4.443, 7.223, -2.396 ], "P_xyz": [ -3.348, 8.806, -4.216 ], "form": ".", "ssZp": 1.121, "Dp": 0.949, "splay_angle": 53.307, "splay_distance": 8.856, "splay_ratio": 0.451, "d22": null, "d64": null, "eta": 170.068, "theta": -38.045, "eta_prime": -165.598, "theta_prime": -62.474, "eta_base": -143.185, "theta_base": -71.168, "v0": -45.361, "v1": 41.723, "v2": -23.223, "v3": -2.094, "v4": 29.604, "amplitude": 45.043, "phase_angle": 121.036, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.017, "origin": [ 35.183, 17.702, 40.885 ], "x_axis": [ -0.226, 0.924, 0.310 ], "y_axis": [ -0.196, 0.269, -0.943 ], "z_axis": [ -0.954, -0.273, 0.120 ], "quaternion": [ 0.539, -0.310, -0.586, 0.519 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 78.493, "beta": -128.593, "gamma": 176.496, "delta": 86.393, "epsilon": -161.320, "zeta": -169.579, "epsilon_zeta": 8.259, "bb_type": "--", "chi": -115.213, "glyco_bond": "anti", "C5prime_xyz": [ -2.969, 8.217, -2.038 ], "P_xyz": [ -2.606, 7.677, -4.642 ], "form": ".", "ssZp": 2.364, "Dp": 4.098, "splay_angle": 47.599, "splay_distance": 7.609, "splay_ratio": 0.416, "d22": null, "d64": null, "eta": 85.400, "theta": 95.730, "eta_prime": 130.280, "theta_prime": 103.006, "eta_base": 137.857, "theta_base": 92.086, "v0": -15.078, "v1": -6.744, "v2": 23.513, "v3": -33.204, "v4": 30.991, "amplitude": 33.290, "phase_angle": 45.064, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.045, "origin": [ 31.475, 22.486, 34.421 ], "x_axis": [ 0.735, 0.294, 0.612 ], "y_axis": [ 0.659, -0.523, -0.540 ], "z_axis": [ 0.161, 0.800, -0.578 ], "quaternion": [ -0.398, 0.842, 0.283, 0.229 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad", "alpha": -63.594, "beta": 130.423, "gamma": 64.995, "delta": 149.823, "epsilon": -150.594, "zeta": -137.752, "epsilon_zeta": -12.843, "bb_type": "--", "chi": -94.501, "glyco_bond": "anti", "C5prime_xyz": [ -2.551, 7.985, -2.081 ], "P_xyz": [ -0.048, 7.621, -2.897 ], "form": ".", "ssZp": 2.101, "Dp": 1.911, "splay_angle": 19.704, "splay_distance": 3.725, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 154.456, "theta": -105.685, "eta_prime": -171.637, "theta_prime": -169.085, "eta_base": 172.670, "theta_base": -146.659, "v0": -15.233, "v1": 31.537, "v2": -34.401, "v3": 27.307, "v4": -7.727, "amplitude": 34.612, "phase_angle": 173.675, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.069, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 28.030, 20.261, 28.011 ], "x_axis": [ 0.297, 0.802, 0.518 ], "y_axis": [ 0.861, 0.010, -0.509 ], "z_axis": [ -0.413, 0.597, -0.687 ], "quaternion": [ -0.394, 0.703, 0.592, 0.038 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad", "alpha": 88.317, "beta": -134.991, "gamma": -157.217, "delta": 84.653, "epsilon": -171.684, "zeta": -75.139, "epsilon_zeta": -96.545, "bb_type": "BI", "chi": -164.562, "glyco_bond": "anti", "C5prime_xyz": [ -2.224, 9.005, 0.620 ], "P_xyz": [ -1.642, 10.772, -1.299 ], "form": "A", "ssZp": 4.258, "Dp": 4.156, "splay_angle": 21.068, "splay_distance": 3.496, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 163.034, "theta": 161.644, "eta_prime": 160.214, "theta_prime": 177.395, "eta_base": -165.455, "theta_base": -156.558, "v0": -18.460, "v1": -4.760, "v2": 23.794, "v3": -35.413, "v4": 34.353, "amplitude": 36.079, "phase_angle": 48.737, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.519, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 25.412, 22.341, 26.370 ], "x_axis": [ 0.610, 0.702, 0.367 ], "y_axis": [ 0.711, -0.281, -0.645 ], "z_axis": [ -0.350, 0.654, -0.671 ], "quaternion": [ -0.406, 0.800, 0.442, 0.005 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,splayed-apart", "alpha": -65.655, "beta": -178.943, "gamma": 64.687, "delta": 139.047, "epsilon": -71.753, "zeta": 81.907, "epsilon_zeta": 206.341, "bb_type": "--", "chi": -129.271, "glyco_bond": "anti", "C5prime_xyz": [ -1.987, 8.810, -0.775 ], "P_xyz": [ 0.434, 9.714, -0.199 ], "form": ".", "ssZp": 0.798, "Dp": 0.739, "splay_angle": 116.400, "splay_distance": 17.631, "splay_ratio": 0.850, "d22": null, "d64": null, "eta": -146.841, "theta": 135.087, "eta_prime": -130.955, "theta_prime": 82.766, "eta_base": -113.038, "theta_base": 74.000, "v0": -23.133, "v1": 34.802, "v2": -32.286, "v3": 20.185, "v4": 1.670, "amplitude": 34.734, "phase_angle": 158.361, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.544, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 23.248, 24.956, 25.529 ], "x_axis": [ 0.902, 0.430, 0.039 ], "y_axis": [ 0.266, -0.484, -0.834 ], "z_axis": [ -0.339, 0.762, -0.551 ], "quaternion": [ -0.466, 0.857, 0.203, -0.088 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,u-turn,anti,~C2'-endo,BII,non-stack,hairpin-loop,splayed-apart", "alpha": 76.485, "beta": -171.319, "gamma": 64.103, "delta": 133.906, "epsilon": -84.903, "zeta": -178.114, "epsilon_zeta": 93.211, "bb_type": "BII", "chi": -108.610, "glyco_bond": "anti", "C5prime_xyz": [ -3.416, 8.317, -1.671 ], "P_xyz": [ -1.597, 10.229, -1.981 ], "form": ".", "ssZp": 1.344, "Dp": 1.135, "splay_angle": 137.932, "splay_distance": 17.184, "splay_ratio": 0.934, "d22": null, "d64": null, "eta": 44.882, "theta": 156.846, "eta_prime": 36.970, "theta_prime": 168.468, "eta_base": 22.651, "theta_base": -140.989, "v0": -37.871, "v1": 44.064, "v2": -33.261, "v3": 12.830, "v4": 15.433, "amplitude": 43.137, "phase_angle": 140.449, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.247, "filter_rmsd": 0.095, "frame": { "rmsd": 0.030, "origin": [ 22.425, 8.813, 18.486 ], "x_axis": [ 0.361, -0.112, -0.926 ], "y_axis": [ -0.017, 0.992, -0.126 ], "z_axis": [ 0.933, 0.061, 0.356 ], "quaternion": [ 0.823, -0.057, 0.565, -0.029 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart", "alpha": -70.643, "beta": -125.716, "gamma": 65.890, "delta": 151.481, "epsilon": -144.153, "zeta": -65.341, "epsilon_zeta": -78.812, "bb_type": "BI", "chi": -149.412, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.556, 0.577 ], "P_xyz": [ -0.129, 8.064, 2.830 ], "form": ".", "ssZp": 1.474, "Dp": 1.883, "splay_angle": 18.620, "splay_distance": 3.394, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -81.360, "theta": -65.660, "eta_prime": -87.591, "theta_prime": -90.801, "eta_base": -107.982, "theta_base": -86.787, "v0": -7.561, "v1": 26.426, "v2": -33.693, "v3": 30.679, "v4": -14.635, "amplitude": 33.894, "phase_angle": 186.234, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 25.137, 20.855, 30.441 ], "x_axis": [ 0.836, 0.111, -0.537 ], "y_axis": [ -0.306, -0.718, -0.625 ], "z_axis": [ -0.455, 0.687, -0.567 ], "quaternion": [ -0.371, 0.883, -0.055, -0.281 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad", "alpha": -98.677, "beta": 167.816, "gamma": 45.814, "delta": 102.165, "epsilon": 126.152, "zeta": -69.024, "epsilon_zeta": -164.824, "bb_type": "--", "chi": -105.419, "glyco_bond": "anti", "C5prime_xyz": [ -3.652, 8.148, -1.905 ], "P_xyz": [ -2.016, 9.950, -2.988 ], "form": ".", "ssZp": 2.788, "Dp": 2.370, "splay_angle": 23.417, "splay_distance": 3.828, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 121.067, "theta": 168.718, "eta_prime": 170.873, "theta_prime": 161.794, "eta_base": -163.512, "theta_base": -161.582, "v0": -39.238, "v1": 34.874, "v2": -17.376, "v3": -5.223, "v4": 28.178, "amplitude": 39.016, "phase_angle": 116.446, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.010, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 23.899, 23.885, 29.545 ], "x_axis": [ 0.672, -0.223, -0.706 ], "y_axis": [ -0.657, -0.619, -0.429 ], "z_axis": [ -0.341, 0.753, -0.563 ], "quaternion": [ -0.350, 0.845, -0.261, -0.310 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad", "alpha": -68.037, "beta": -143.454, "gamma": 52.669, "delta": 142.367, "epsilon": -72.493, "zeta": 83.926, "epsilon_zeta": 203.582, "bb_type": "--", "chi": -115.230, "glyco_bond": "anti", "C5prime_xyz": [ -1.901, 8.428, -1.361 ], "P_xyz": [ 0.211, 9.581, -0.237 ], "form": ".", "ssZp": 0.710, "Dp": 1.004, "splay_angle": 33.637, "splay_distance": 5.772, "splay_ratio": 0.295, "d22": null, "d64": null, "eta": -141.217, "theta": 162.546, "eta_prime": -139.056, "theta_prime": 151.860, "eta_base": -113.144, "theta_base": -160.990, "v0": -14.906, "v1": 27.745, "v2": -28.526, "v3": 21.403, "v4": -4.292, "amplitude": 29.053, "phase_angle": 169.069, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 23.177, 27.468, 28.408 ], "x_axis": [ 0.248, -0.476, -0.844 ], "y_axis": [ -0.881, -0.473, 0.007 ], "z_axis": [ -0.402, 0.742, -0.536 ], "quaternion": [ -0.244, 0.751, -0.452, -0.415 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,non-pair-contact,hairpin-loop", "alpha": 77.813, "beta": -115.904, "gamma": -170.187, "delta": 147.178, "epsilon": -72.880, "zeta": -157.687, "epsilon_zeta": 84.807, "bb_type": "BII", "chi": -144.893, "glyco_bond": "anti", "C5prime_xyz": [ -1.678, 8.614, 0.436 ], "P_xyz": [ 0.406, 9.115, -1.155 ], "form": ".", "ssZp": 0.922, "Dp": 0.816, "splay_angle": 62.075, "splay_distance": 10.765, "splay_ratio": 0.516, "d22": null, "d64": null, "eta": -97.820, "theta": 163.467, "eta_prime": -116.708, "theta_prime": 156.948, "eta_base": -81.021, "theta_base": 128.146, "v0": -12.956, "v1": 29.310, "v2": -33.350, "v3": 26.996, "v4": -8.977, "amplitude": 33.413, "phase_angle": 176.492, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.028, "origin": [ 21.225, 31.972, 31.445 ], "x_axis": [ -0.607, 0.624, -0.493 ], "y_axis": [ -0.790, -0.541, 0.288 ], "z_axis": [ -0.087, 0.564, 0.821 ], "quaternion": [ 0.410, -0.168, 0.247, 0.861 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad", "alpha": -72.603, "beta": 136.898, "gamma": -63.880, "delta": 153.943, "epsilon": -156.065, "zeta": -79.167, "epsilon_zeta": -76.898, "bb_type": "BI", "chi": -125.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.473, 8.470, -0.686 ], "P_xyz": [ -0.969, 10.605, 0.801 ], "form": ".", "ssZp": 1.335, "Dp": 1.797, "splay_angle": 18.583, "splay_distance": 3.344, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 66.022, "theta": -120.979, "eta_prime": 80.377, "theta_prime": -123.203, "eta_base": 67.633, "theta_base": -102.603, "v0": -7.980, "v1": 27.924, "v2": -35.253, "v3": 32.316, "v4": -15.568, "amplitude": 35.468, "phase_angle": 186.301, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 27.506, 23.263, 32.204 ], "x_axis": [ -0.362, -0.634, -0.683 ], "y_axis": [ -0.877, -0.015, 0.479 ], "z_axis": [ -0.315, 0.773, -0.551 ], "quaternion": [ 0.134, -0.549, 0.689, 0.455 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad", "alpha": -88.707, "beta": 170.167, "gamma": 44.766, "delta": 134.830, "epsilon": -85.770, "zeta": 162.599, "epsilon_zeta": 111.631, "bb_type": "BII", "chi": -96.791, "glyco_bond": "anti", "C5prime_xyz": [ -3.734, 7.979, -1.977 ], "P_xyz": [ -2.079, 9.886, -2.790 ], "form": "B", "ssZp": 1.556, "Dp": 1.214, "splay_angle": 20.752, "splay_distance": 3.548, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 159.935, "theta": 174.366, "eta_prime": -168.353, "theta_prime": 175.099, "eta_base": -144.053, "theta_base": -145.035, "v0": -40.278, "v1": 46.672, "v2": -34.646, "v3": 12.975, "v4": 16.755, "amplitude": 45.491, "phase_angle": 139.606, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 27.176, 25.786, 30.034 ], "x_axis": [ -0.641, -0.664, -0.385 ], "y_axis": [ -0.690, 0.280, 0.667 ], "z_axis": [ -0.335, 0.694, -0.638 ], "quaternion": [ 0.016, -0.423, 0.800, 0.425 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad", "alpha": -74.619, "beta": 132.420, "gamma": 40.818, "delta": 139.063, "epsilon": -75.964, "zeta": -162.717, "epsilon_zeta": 86.754, "bb_type": "BII", "chi": -111.463, "glyco_bond": "anti", "C5prime_xyz": [ -3.181, 8.431, -1.676 ], "P_xyz": [ -0.833, 9.677, -1.605 ], "form": "B", "ssZp": 0.871, "Dp": 1.127, "splay_angle": 20.705, "splay_distance": 3.471, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -169.596, "theta": -139.153, "eta_prime": -155.108, "theta_prime": -151.388, "eta_base": -120.953, "theta_base": -128.066, "v0": -37.432, "v1": 47.089, "v2": -37.794, "v3": 17.841, "v4": 11.921, "amplitude": 45.614, "phase_angle": 145.951, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.184, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 26.722, 28.516, 27.814 ], "x_axis": [ -0.912, -0.410, -0.026 ], "y_axis": [ -0.271, 0.553, 0.788 ], "z_axis": [ -0.309, 0.725, -0.615 ], "quaternion": [ -0.081, -0.194, 0.877, 0.431 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -82.118, "beta": 128.899, "gamma": 36.732, "delta": 131.780, "epsilon": -89.337, "zeta": 177.124, "epsilon_zeta": 93.539, "bb_type": "BII", "chi": -89.515, "glyco_bond": "anti", "C5prime_xyz": [ -3.771, 7.679, -2.360 ], "P_xyz": [ -1.580, 8.914, -3.275 ], "form": "B", "ssZp": 1.282, "Dp": 1.190, "splay_angle": 18.044, "splay_distance": 3.152, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 163.224, "theta": -167.334, "eta_prime": -176.172, "theta_prime": -170.253, "eta_base": -150.869, "theta_base": -124.768, "v0": -39.271, "v1": 45.657, "v2": -34.130, "v3": 12.317, "v4": 16.926, "amplitude": 44.846, "phase_angle": 139.555, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.055, "frame": { "rmsd": 0.031, "origin": [ 26.688, 31.121, 25.520 ], "x_axis": [ -0.931, -0.151, 0.333 ], "y_axis": [ 0.119, 0.736, 0.666 ], "z_axis": [ -0.346, 0.660, -0.667 ], "quaternion": [ -0.186, -0.009, 0.913, 0.363 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -71.321, "beta": 120.630, "gamma": 51.670, "delta": 137.607, "epsilon": -147.726, "zeta": -159.146, "epsilon_zeta": 11.419, "bb_type": "--", "chi": -86.341, "glyco_bond": "anti", "C5prime_xyz": [ -3.788, 7.591, -2.468 ], "P_xyz": [ -1.440, 8.278, -3.516 ], "form": "B", "ssZp": 2.118, "Dp": 2.201, "splay_angle": 24.596, "splay_distance": 4.056, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 160.440, "theta": -166.375, "eta_prime": -169.658, "theta_prime": 175.823, "eta_base": -128.107, "theta_base": -138.432, "v0": -37.695, "v1": 46.133, "v2": -36.240, "v3": 15.946, "v4": 13.415, "amplitude": 44.845, "phase_angle": 143.913, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.050, "filter_rmsd": 0.054, "frame": { "rmsd": 0.018, "origin": [ 25.982, 33.936, 24.292 ], "x_axis": [ -0.736, 0.260, 0.626 ], "y_axis": [ 0.498, 0.833, 0.239 ], "z_axis": [ -0.459, 0.488, -0.743 ], "quaternion": [ -0.298, 0.208, 0.910, 0.200 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.578, "beta": 158.373, "gamma": 53.375, "delta": 144.379, "epsilon": -176.966, "zeta": -88.432, "epsilon_zeta": -88.533, "bb_type": "BI", "chi": -115.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.972, 8.501, -1.187 ], "P_xyz": [ 0.642, 8.906, -0.956 ], "form": ".", "ssZp": 2.382, "Dp": 2.134, "splay_angle": 20.342, "splay_distance": 3.682, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 160.556, "theta": -112.491, "eta_prime": -177.171, "theta_prime": -141.795, "eta_base": -130.133, "theta_base": -100.863, "v0": -13.521, "v1": 29.727, "v2": -32.857, "v3": 26.455, "v4": -8.449, "amplitude": 32.969, "phase_angle": 175.283, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.089, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 24.637, 36.544, 21.492 ], "x_axis": [ -0.106, 0.520, 0.847 ], "y_axis": [ 0.889, 0.432, -0.154 ], "z_axis": [ -0.446, 0.737, -0.508 ], "quaternion": [ -0.452, 0.493, 0.715, 0.204 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/25", "linked_nts": [ "///A/24", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -71.576, "beta": 174.307, "gamma": 55.555, "delta": 113.879, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -128.990, "glyco_bond": "anti", "C5prime_xyz": [ -2.692, 8.780, -1.335 ], "P_xyz": [ -0.607, 10.418, -1.376 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -36.119, "v1": 31.238, "v2": -15.226, "v3": -5.343, "v4": 26.102, "amplitude": 35.531, "phase_angle": 115.374, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.015, "origin": [ 22.518, 39.530, 21.104 ], "x_axis": [ 0.467, 0.672, 0.575 ], "y_axis": [ 0.747, 0.048, -0.663 ], "z_axis": [ -0.473, 0.739, -0.479 ], "quaternion": [ 0.509, -0.689, -0.515, -0.037 ] } } ], "num_hbonds": 39, "hbonds": [ { "index": 1, "atom1_serNum": 14, "atom2_serNum": 792, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/1/O6", "atom2_id": "///A/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 15, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/1/N1", "atom2_id": "///A/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 17, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/1/N2", "atom2_id": "///A/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 45, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/2/O2", "atom2_id": "///A/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 46, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/2/N3", "atom2_id": "///A/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 48, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/2/N4", "atom2_id": "///A/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 78, "atom2_serNum": 729, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/3/O6", "atom2_id": "///A/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 79, "atom2_serNum": 727, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/3/N1", "atom2_id": "///A/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 81, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/3/N2", "atom2_id": "///A/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 109, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/4/N3", "atom2_id": "///A/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 111, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/4/O4", "atom2_id": "///A/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 140, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/5/N7", "atom2_id": "///A/21/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 143, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/5/O6", "atom2_id": "///A/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 144, "atom2_serNum": 402, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/5/N1", "atom2_id": "///A/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 146, "atom2_serNum": 399, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/5/N2", "atom2_id": "///A/13/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 170, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/6/N7", "atom2_id": "///A/20/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 175, "atom2_serNum": 366, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/6/N2", "atom2_id": "///A/12/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 176, "atom2_serNum": 369, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/6/N1", "atom2_id": "///A/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 178, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/6/O6", "atom2_id": "///A/20/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 203, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/7/N7", "atom2_id": "///A/19/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 208, "atom2_serNum": 333, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/7/N2", "atom2_id": "///A/11/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 209, "atom2_serNum": 336, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/7/N1", "atom2_id": "///A/11/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 211, "atom2_serNum": 599, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/7/O6", "atom2_id": "///A/19/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 211, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/7/O6", "atom2_id": "///A/20/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 337, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/11/N1", "atom2_id": "///A/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 339, "atom2_serNum": 464, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/11/N2", "atom2_id": "///A/15/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 370, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/12/N1", "atom2_id": "///A/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 372, "atom2_serNum": 453, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/12/N2", "atom2_id": "///A/15/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 372, "atom2_serNum": 497, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/12/N2", "atom2_id": "///A/16/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 403, "atom2_serNum": 533, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/13/N1", "atom2_id": "///A/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 405, "atom2_serNum": 530, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/13/N2", "atom2_id": "///A/17/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 468, "atom2_serNum": 598, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/15/N1", "atom2_id": "///A/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 470, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/15/N2", "atom2_id": "///A/19/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 501, "atom2_serNum": 631, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/16/N1", "atom2_id": "///A/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 503, "atom2_serNum": 628, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/16/N2", "atom2_id": "///A/20/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 523, "atom2_serNum": 556, "donAcc_type": "questionable", "distance": 3.072, "atom1_id": "///A/17/O4'", "atom2_id": "///A/18/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 534, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/17/N1", "atom2_id": "///A/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 536, "atom2_serNum": 563, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/17/N2", "atom2_id": "///A/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 536, "atom2_serNum": 661, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/17/N2", "atom2_id": "///A/21/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "https://x3dna.org/", "web_dssr": "https://web.x3dna-dssr.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6r9k", "num_naChains": 1, "naChains": "A=25", "num_atoms": 806, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }