{ "num_pairs": 56, "pairs": [ { "index": 1, "nt1": "///D/2", "nt2": "///E/42", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.248, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.257, "chi2": -167.352, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.800, "C1C1_dist": 10.644, "N1N9_dist": 8.814, "C6C8_dist": 9.667, "CNNC_torsion": 3.811, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.79]", "interBase_angle": 16.748, "planarity": 0.270, "simple_Shear": -0.107, "simple_Stretch": -0.279, "simple_Buckle": 4.346, "simple_Propeller": 16.174, "bp_simpleParams": [ -0.107, -0.279, 0.781, 4.346, 16.174, -0.746 ], "bp_params": [ -0.103, -0.280, 0.781, 4.110, 16.236, -0.753 ], "frame": { "rmsd": null, "origin": [ 133.325, 173.797, 117.981 ], "x_axis": [ -0.944, -0.237, -0.228 ], "y_axis": [ 0.310, -0.873, -0.377 ], "z_axis": [ -0.110, -0.426, 0.898 ], "quaternion": [ -0.142, -0.088, -0.208, 0.964 ] } }, { "index": 2, "nt1": "///D/3", "nt2": "///E/41", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.401, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.380, "chi2": -176.608, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.121, "C1C1_dist": 10.929, "N1N9_dist": 9.127, "C6C8_dist": 9.946, "CNNC_torsion": 0.284, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.01],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 5.233, "planarity": 0.069, "simple_Shear": -0.037, "simple_Stretch": 0.026, "simple_Buckle": -5.233, "simple_Propeller": -0.047, "bp_simpleParams": [ -0.037, 0.026, -0.025, -5.233, -0.047, -4.470 ], "bp_params": [ -0.037, 0.025, -0.025, -5.232, -0.090, -4.465 ], "frame": { "rmsd": null, "origin": [ 130.794, 173.554, 121.941 ], "x_axis": [ -0.525, -0.519, -0.675 ], "y_axis": [ 0.711, -0.703, -0.012 ], "z_axis": [ -0.468, -0.486, 0.738 ], "quaternion": [ -0.357, -0.332, -0.145, 0.861 ] } }, { "index": 3, "nt1": "///D/4", "nt2": "///E/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -171.285, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.956, "chi2": -171.861, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.194, "C1C1_dist": 10.788, "N1N9_dist": 8.958, "C6C8_dist": 9.843, "CNNC_torsion": -0.426, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 5.946, "planarity": 0.130, "simple_Shear": -0.163, "simple_Stretch": -0.173, "simple_Buckle": -2.024, "simple_Propeller": 5.591, "bp_simpleParams": [ -0.163, -0.173, 0.366, -2.024, 5.591, -0.710 ], "bp_params": [ -0.161, -0.175, 0.366, -2.090, 5.567, -0.711 ], "frame": { "rmsd": null, "origin": [ 127.756, 172.662, 123.986 ], "x_axis": [ -0.074, -0.609, -0.790 ], "y_axis": [ 0.867, -0.431, 0.251 ], "z_axis": [ -0.493, -0.666, 0.559 ], "quaternion": [ 0.513, 0.447, 0.145, -0.718 ] } }, { "index": 4, "nt1": "///D/5", "nt2": "///E/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.862, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.545, "chi2": -178.324, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.039, "C1C1_dist": 10.826, "N1N9_dist": 9.043, "C6C8_dist": 9.886, "CNNC_torsion": -0.784, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 3.538, "planarity": 0.106, "simple_Shear": 0.158, "simple_Stretch": -0.106, "simple_Buckle": 2.648, "simple_Propeller": 2.346, "bp_simpleParams": [ 0.158, -0.106, 0.312, 2.648, 2.346, -1.352 ], "bp_params": [ 0.157, -0.108, 0.312, 2.673, 2.317, -1.352 ], "frame": { "rmsd": null, "origin": [ 124.880, 170.392, 124.622 ], "x_axis": [ 0.537, -0.650, -0.539 ], "y_axis": [ 0.695, -0.022, 0.719 ], "z_axis": [ -0.479, -0.760, 0.439 ], "quaternion": [ 0.699, 0.529, 0.021, -0.481 ] } }, { "index": 5, "nt1": "///D/6", "nt2": "///E/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 177.360, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.270, "chi2": -156.098, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.452, "C1C1_dist": 10.669, "N1N9_dist": 8.964, "C6C8_dist": 9.957, "CNNC_torsion": -6.421, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 8.661, "planarity": 0.114, "simple_Shear": -0.265, "simple_Stretch": -0.040, "simple_Buckle": -6.240, "simple_Propeller": -6.006, "bp_simpleParams": [ -0.265, -0.040, 0.063, -6.240, -6.006, 4.192 ], "bp_params": [ -0.264, -0.045, 0.063, -6.119, -6.128, 4.192 ], "frame": { "rmsd": null, "origin": [ 122.614, 167.412, 124.454 ], "x_axis": [ 0.908, -0.294, -0.300 ], "y_axis": [ 0.365, 0.200, 0.909 ], "z_axis": [ -0.207, -0.935, 0.288 ], "quaternion": [ 0.774, 0.596, 0.030, -0.213 ] } }, { "index": 6, "nt1": "///D/7", "nt2": "///E/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -179.364, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.601, "chi2": -145.937, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.925, "C1C1_dist": 11.174, "N1N9_dist": 9.158, "C6C8_dist": 9.882, "CNNC_torsion": -2.536, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.00],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 5.823, "planarity": 0.094, "simple_Shear": -0.131, "simple_Stretch": -0.015, "simple_Buckle": -5.308, "simple_Propeller": 2.394, "bp_simpleParams": [ -0.131, -0.015, -0.123, -5.308, 2.394, -7.963 ], "bp_params": [ -0.130, -0.017, -0.123, -5.349, 2.300, -7.956 ], "frame": { "rmsd": null, "origin": [ 121.229, 163.934, 124.087 ], "x_axis": [ 0.971, -0.047, 0.233 ], "y_axis": [ -0.210, 0.290, 0.934 ], "z_axis": [ -0.111, -0.956, 0.272 ], "quaternion": [ 0.796, 0.594, -0.108, 0.051 ] } }, { "index": 7, "nt1": "///D/8", "nt2": "///E/36", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.141, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.868, "chi2": -177.761, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.699, "C1C1_dist": 10.657, "N1N9_dist": 8.890, "C6C8_dist": 9.774, "CNNC_torsion": 3.553, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 12.007, "planarity": 0.158, "simple_Shear": 0.023, "simple_Stretch": -0.116, "simple_Buckle": 10.762, "simple_Propeller": 5.324, "bp_simpleParams": [ 0.023, -0.116, -0.021, 10.762, 5.324, -2.306 ], "bp_params": [ 0.023, -0.116, -0.021, 10.768, 5.313, -2.298 ], "frame": { "rmsd": null, "origin": [ 122.123, 160.523, 123.897 ], "x_axis": [ 0.733, 0.315, 0.603 ], "y_axis": [ -0.669, 0.172, 0.723 ], "z_axis": [ 0.124, -0.933, 0.337 ], "quaternion": [ 0.749, 0.553, -0.160, 0.329 ] } }, { "index": 8, "nt1": "///D/9", "nt2": "///E/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.159, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.477, "chi2": -172.658, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.474, "C1C1_dist": 10.909, "N1N9_dist": 8.989, "C6C8_dist": 9.816, "CNNC_torsion": -16.171, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 15.533, "planarity": 0.200, "simple_Shear": -0.200, "simple_Stretch": -0.174, "simple_Buckle": -5.245, "simple_Propeller": -14.620, "bp_simpleParams": [ -0.200, -0.174, 0.225, -5.245, -14.620, -2.661 ], "bp_params": [ -0.198, -0.176, 0.225, -5.035, -14.694, -2.680 ], "frame": { "rmsd": null, "origin": [ 123.640, 156.957, 124.359 ], "x_axis": [ 0.244, 0.511, 0.824 ], "y_axis": [ -0.958, -0.007, 0.288 ], "z_axis": [ 0.153, -0.860, 0.487 ], "quaternion": [ 0.656, 0.437, -0.256, 0.559 ] } }, { "index": 9, "nt1": "///D/10", "nt2": "///E/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.646, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.895, "chi2": -156.950, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.447, "C1C1_dist": 11.127, "N1N9_dist": 9.462, "C6C8_dist": 10.450, "CNNC_torsion": -11.871, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.76],N1-N3(imino)[3.46]", "interBase_angle": 15.839, "planarity": 0.217, "simple_Shear": 0.581, "simple_Stretch": 0.555, "simple_Buckle": -4.583, "simple_Propeller": -15.161, "bp_simpleParams": [ 0.581, 0.555, 0.157, -4.583, -15.161, 2.375 ], "bp_params": [ 0.617, 0.515, 0.157, -5.564, -14.829, 2.392 ], "frame": { "rmsd": null, "origin": [ 125.180, 154.017, 125.784 ], "x_axis": [ -0.367, 0.402, 0.839 ], "y_axis": [ -0.920, -0.294, -0.261 ], "z_axis": [ 0.141, -0.867, 0.477 ], "quaternion": [ 0.452, 0.335, -0.386, 0.731 ] } }, { "index": 10, "nt1": "///D/11", "nt2": "///E/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.944, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.249, "chi2": -160.978, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.443, "C1C1_dist": 10.597, "N1N9_dist": 8.929, "C6C8_dist": 9.914, "CNNC_torsion": -12.530, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.11]", "interBase_angle": 11.256, "planarity": 0.145, "simple_Shear": -0.036, "simple_Stretch": -0.019, "simple_Buckle": -0.058, "simple_Propeller": -11.256, "bp_simpleParams": [ -0.036, -0.019, 0.182, -0.058, -11.256, 2.174 ], "bp_params": [ -0.036, -0.020, 0.182, 0.033, -11.256, 2.185 ], "frame": { "rmsd": null, "origin": [ 126.908, 151.926, 128.511 ], "x_axis": [ -0.710, 0.271, 0.650 ], "y_axis": [ -0.693, -0.434, -0.576 ], "z_axis": [ 0.126, -0.859, 0.496 ], "quaternion": [ 0.297, 0.239, -0.442, 0.812 ] } }, { "index": 11, "nt1": "///D/12", "nt2": "///E/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.981, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.587, "chi2": -160.738, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.294, "C1C1_dist": 10.676, "N1N9_dist": 8.911, "C6C8_dist": 9.845, "CNNC_torsion": -10.876, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.89]", "interBase_angle": 10.488, "planarity": 0.147, "simple_Shear": 0.138, "simple_Stretch": -0.081, "simple_Buckle": -2.956, "simple_Propeller": -10.063, "bp_simpleParams": [ 0.138, -0.081, 0.118, -2.956, -10.063, -0.587 ], "bp_params": [ 0.136, -0.083, 0.118, -3.141, -10.007, -0.589 ], "frame": { "rmsd": null, "origin": [ 128.111, 149.669, 131.210 ], "x_axis": [ -0.976, 0.122, 0.179 ], "y_axis": [ -0.216, -0.530, -0.820 ], "z_axis": [ -0.005, -0.839, 0.543 ], "quaternion": [ 0.097, 0.050, -0.475, 0.873 ] } }, { "index": 12, "nt1": "///D/13", "nt2": "///E/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.769, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.720, "chi2": -159.656, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.231, "C1C1_dist": 10.747, "N1N9_dist": 8.971, "C6C8_dist": 9.901, "CNNC_torsion": -5.602, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.97]", "interBase_angle": 6.220, "planarity": 0.083, "simple_Shear": -0.000, "simple_Stretch": -0.026, "simple_Buckle": -2.096, "simple_Propeller": -5.857, "bp_simpleParams": [ -0.000, -0.026, -0.108, -2.096, -5.857, -0.663 ], "bp_params": [ -0.000, -0.026, -0.108, -2.123, -5.847, -0.664 ], "frame": { "rmsd": null, "origin": [ 128.197, 147.354, 134.029 ], "x_axis": [ -0.930, -0.140, -0.339 ], "y_axis": [ 0.360, -0.524, -0.772 ], "z_axis": [ -0.069, -0.840, 0.538 ], "quaternion": [ -0.144, -0.118, -0.466, 0.865 ] } }, { "index": 13, "nt1": "///D/14", "nt2": "///E/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.295, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.412, "chi2": -156.630, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.876, "C1C1_dist": 10.876, "N1N9_dist": 9.437, "C6C8_dist": 10.619, "CNNC_torsion": 1.675, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.68]", "interBase_angle": 2.395, "planarity": 0.051, "simple_Shear": -0.624, "simple_Stretch": 0.753, "simple_Buckle": -1.364, "simple_Propeller": -1.968, "bp_simpleParams": [ -0.624, 0.753, -0.250, -1.364, -1.968, 11.153 ], "bp_params": [ -0.667, 0.716, -0.250, -1.248, -2.044, 11.154 ], "frame": { "rmsd": null, "origin": [ 126.139, 144.875, 136.568 ], "x_axis": [ -0.710, -0.288, -0.643 ], "y_axis": [ 0.693, -0.450, -0.563 ], "z_axis": [ -0.127, -0.845, 0.519 ], "quaternion": [ -0.300, -0.235, -0.430, 0.818 ] } }, { "index": 14, "nt1": "///D/15", "nt2": "///E/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.759, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.567, "chi2": -163.328, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.231, "C1C1_dist": 10.723, "N1N9_dist": 9.002, "C6C8_dist": 9.962, "CNNC_torsion": -2.435, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.13],N1-N3(imino)[2.98]", "interBase_angle": 5.120, "planarity": 0.068, "simple_Shear": 0.133, "simple_Stretch": 0.026, "simple_Buckle": -0.577, "simple_Propeller": -5.087, "bp_simpleParams": [ 0.133, 0.026, -0.133, -0.577, -5.087, 0.519 ], "bp_params": [ 0.133, 0.024, -0.133, -0.665, -5.077, 0.519 ], "frame": { "rmsd": null, "origin": [ 124.218, 142.689, 139.539 ], "x_axis": [ -0.281, -0.362, -0.889 ], "y_axis": [ 0.948, -0.250, -0.198 ], "z_axis": [ -0.150, -0.898, 0.413 ], "quaternion": [ -0.470, -0.373, -0.393, 0.697 ] } }, { "index": 15, "nt1": "///D/16", "nt2": "///E/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.402, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.379, "chi2": -171.120, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.755, "C1C1_dist": 10.950, "N1N9_dist": 9.065, "C6C8_dist": 9.947, "CNNC_torsion": -3.194, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.01],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 6.913, "planarity": 0.101, "simple_Shear": -0.218, "simple_Stretch": -0.061, "simple_Buckle": -4.584, "simple_Propeller": -5.175, "bp_simpleParams": [ -0.218, -0.061, -0.430, -4.584, -5.175, -0.369 ], "bp_params": [ -0.217, -0.065, -0.430, -4.498, -5.249, -0.369 ], "frame": { "rmsd": null, "origin": [ 121.371, 139.677, 140.912 ], "x_axis": [ 0.235, -0.330, -0.915 ], "y_axis": [ 0.954, -0.104, 0.282 ], "z_axis": [ -0.188, -0.938, 0.290 ], "quaternion": [ 0.596, 0.512, 0.305, -0.538 ] } }, { "index": 16, "nt1": "///D/17", "nt2": "///E/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -170.865, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.724, "chi2": -165.889, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.319, "C1C1_dist": 10.837, "N1N9_dist": 9.283, "C6C8_dist": 10.397, "CNNC_torsion": -6.467, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.40],O4(carbonyl)-N6(amino)[3.82]", "interBase_angle": 8.472, "planarity": 0.103, "simple_Shear": -0.236, "simple_Stretch": 0.527, "simple_Buckle": 3.671, "simple_Propeller": -7.636, "bp_simpleParams": [ -0.236, 0.527, -0.056, 3.671, -7.636, 9.125 ], "bp_params": [ -0.251, 0.520, -0.056, 3.896, -7.523, 9.140 ], "frame": { "rmsd": null, "origin": [ 118.870, 136.262, 139.914 ], "x_axis": [ 0.542, -0.285, -0.791 ], "y_axis": [ 0.827, 0.016, 0.561 ], "z_axis": [ -0.148, -0.958, 0.244 ], "quaternion": [ 0.671, 0.566, 0.240, -0.414 ] } }, { "index": 17, "nt1": "///D/18", "nt2": "///E/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.917, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.326, "chi2": -152.624, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.910, "C1C1_dist": 10.272, "N1N9_dist": 8.909, "C6C8_dist": 10.226, "CNNC_torsion": -18.434, "hbonds_num": 2, "hbonds_desc": "N1*O2(carbonyl)[3.15],N1-N3(imino)[3.41]", "unusual_base2base_hbonds": 1, "interBase_angle": 21.850, "planarity": 0.297, "simple_Shear": -1.222, "simple_Stretch": 0.540, "simple_Buckle": -9.116, "simple_Propeller": -19.858, "bp_simpleParams": [ -1.222, 0.540, 0.060, -9.116, -19.858, 19.184 ], "bp_params": [ -1.275, 0.399, 0.060, -6.756, -20.780, 19.466 ], "frame": { "rmsd": null, "origin": [ 118.154, 132.542, 138.839 ], "x_axis": [ 0.900, -0.114, -0.420 ], "y_axis": [ 0.428, 0.055, 0.902 ], "z_axis": [ -0.080, -0.992, 0.098 ], "quaternion": [ 0.716, 0.661, 0.119, -0.189 ] } }, { "index": 18, "nt1": "///D/19", "nt2": "///E/25", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.440, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.930, "chi2": -164.232, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.403, "C1C1_dist": 10.925, "N1N9_dist": 9.462, "C6C8_dist": 10.599, "CNNC_torsion": -12.707, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.58]", "interBase_angle": 15.485, "planarity": 0.191, "simple_Shear": -0.261, "simple_Stretch": 0.723, "simple_Buckle": -1.383, "simple_Propeller": -15.423, "bp_simpleParams": [ -0.261, 0.723, -0.100, -1.383, -15.423, 10.165 ], "bp_params": [ -0.283, 0.714, -0.100, -0.892, -15.459, 10.257 ], "frame": { "rmsd": null, "origin": [ 117.616, 129.039, 138.389 ], "x_axis": [ 0.985, -0.052, 0.162 ], "y_axis": [ -0.158, 0.079, 0.984 ], "z_axis": [ -0.064, -0.996, 0.070 ], "quaternion": [ 0.730, 0.678, -0.077, 0.036 ] } }, { "index": 19, "nt1": "///D/20", "nt2": "///E/24", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.546, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.121, "chi2": -111.027, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.744, "C1C1_dist": 11.005, "N1N9_dist": 9.449, "C6C8_dist": 10.576, "CNNC_torsion": 5.631, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.67]", "interBase_angle": 8.757, "planarity": 0.100, "simple_Shear": 0.578, "simple_Stretch": 0.747, "simple_Buckle": 7.389, "simple_Propeller": 4.699, "bp_simpleParams": [ 0.578, 0.747, -0.313, 7.389, 4.699, 10.181 ], "bp_params": [ 0.618, 0.714, -0.313, 7.635, 4.287, 10.166 ], "frame": { "rmsd": null, "origin": [ 118.570, 125.130, 136.687 ], "x_axis": [ 0.833, -0.149, 0.533 ], "y_axis": [ -0.515, 0.144, 0.845 ], "z_axis": [ -0.202, -0.978, 0.043 ], "quaternion": [ 0.711, 0.642, -0.259, 0.129 ] } }, { "index": 20, "nt1": "///D/21", "nt2": "///D/67", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.694, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 36.726, "chi2": -155.142, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.714, "C1C1_dist": 10.810, "N1N9_dist": 9.033, "C6C8_dist": 9.770, "CNNC_torsion": -11.152, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.91],N1(imino)-O2(carbonyl)[3.03]", "interBase_angle": 7.011, "planarity": 0.106, "simple_Shear": -2.382, "simple_Stretch": 0.090, "simple_Buckle": 1.972, "simple_Propeller": -6.728, "bp_simpleParams": [ -2.382, 0.090, 0.373, 1.972, -6.728, -7.172 ], "bp_params": [ -2.336, -0.474, 0.373, 3.501, -6.074, -7.179 ], "frame": { "rmsd": null, "origin": [ 120.493, 121.766, 139.497 ], "x_axis": [ 0.028, 0.201, 0.979 ], "y_axis": [ -0.968, 0.251, -0.023 ], "z_axis": [ -0.250, -0.947, 0.201 ], "quaternion": [ 0.608, 0.380, -0.505, 0.480 ] } }, { "index": 21, "nt1": "///D/22", "nt2": "///D/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.475, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.303, "chi2": -160.461, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.294, "C1C1_dist": 10.869, "N1N9_dist": 9.067, "C6C8_dist": 9.940, "CNNC_torsion": -4.644, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.98],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 4.364, "planarity": 0.052, "simple_Shear": -0.150, "simple_Stretch": 0.021, "simple_Buckle": 1.694, "simple_Propeller": -4.022, "bp_simpleParams": [ -0.150, 0.021, -0.016, 1.694, -4.022, -2.109 ], "bp_params": [ -0.151, 0.018, -0.016, 1.773, -3.988, -2.110 ], "frame": { "rmsd": null, "origin": [ 120.936, 117.902, 140.491 ], "x_axis": [ -0.538, 0.458, 0.708 ], "y_axis": [ -0.764, 0.089, -0.639 ], "z_axis": [ -0.356, -0.884, 0.302 ], "quaternion": [ 0.462, 0.133, -0.575, 0.662 ] } }, { "index": 22, "nt1": "///D/23", "nt2": "///D/65", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.296, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.346, "chi2": -165.182, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.142, "C1C1_dist": 10.647, "N1N9_dist": 9.001, "C6C8_dist": 9.923, "CNNC_torsion": -8.681, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.96],N3(imino)-O6(carbonyl)[3.11]", "interBase_angle": 6.285, "planarity": 0.087, "simple_Shear": 2.062, "simple_Stretch": 0.153, "simple_Buckle": 3.314, "simple_Propeller": -5.340, "bp_simpleParams": [ 2.062, 0.153, 0.155, 3.314, -5.340, 0.356 ], "bp_params": [ 2.051, -0.267, 0.155, 2.165, -5.900, 0.357 ], "frame": { "rmsd": null, "origin": [ 120.228, 115.157, 142.914 ], "x_axis": [ -0.830, 0.550, 0.094 ], "y_axis": [ -0.273, -0.254, -0.928 ], "z_axis": [ -0.487, -0.795, 0.361 ], "quaternion": [ 0.264, -0.126, -0.551, 0.782 ] } }, { "index": 23, "nt1": "///D/24", "nt2": "///D/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.477, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.306, "chi2": -166.763, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.020, "C1C1_dist": 10.775, "N1N9_dist": 8.991, "C6C8_dist": 9.862, "CNNC_torsion": -16.416, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.95],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 11.771, "planarity": 0.175, "simple_Shear": -0.135, "simple_Stretch": -0.054, "simple_Buckle": -1.345, "simple_Propeller": -11.694, "bp_simpleParams": [ -0.135, -0.054, 0.441, -1.345, -11.694, -2.498 ], "bp_params": [ -0.134, -0.056, 0.441, -1.141, -11.716, -2.511 ], "frame": { "rmsd": null, "origin": [ 119.126, 113.210, 146.130 ], "x_axis": [ -0.762, 0.531, -0.370 ], "y_axis": [ 0.097, -0.472, -0.876 ], "z_axis": [ -0.640, -0.704, 0.308 ], "quaternion": [ 0.136, -0.317, -0.496, 0.797 ] } }, { "index": 24, "nt1": "///D/25", "nt2": "///D/63", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.987, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.441, "chi2": -172.668, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.203, "C1C1_dist": 11.111, "N1N9_dist": 9.130, "C6C8_dist": 9.899, "CNNC_torsion": -16.551, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.01],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 12.495, "planarity": 0.161, "simple_Shear": -0.067, "simple_Stretch": 0.010, "simple_Buckle": -1.866, "simple_Propeller": -12.354, "bp_simpleParams": [ -0.067, 0.010, 0.165, -1.866, -12.354, -4.933 ], "bp_params": [ -0.067, 0.009, 0.165, -1.724, -12.375, -4.961 ], "frame": { "rmsd": null, "origin": [ 116.630, 111.698, 148.158 ], "x_axis": [ -0.497, 0.266, -0.826 ], "y_axis": [ 0.466, -0.722, -0.512 ], "z_axis": [ -0.732, -0.639, 0.235 ], "quaternion": [ -0.064, -0.497, -0.368, 0.783 ] } }, { "index": 25, "nt1": "///D/26", "nt2": "///D/62", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.006, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.723, "chi2": -158.426, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.247, "C1C1_dist": 10.820, "N1N9_dist": 9.067, "C6C8_dist": 9.957, "CNNC_torsion": -9.559, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.01],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 10.255, "planarity": 0.123, "simple_Shear": 0.040, "simple_Stretch": 0.030, "simple_Buckle": 0.493, "simple_Propeller": -10.243, "bp_simpleParams": [ 0.040, 0.030, 0.006, 0.493, -10.243, -1.556 ], "bp_params": [ 0.040, 0.030, 0.006, 0.507, -10.242, -1.562 ], "frame": { "rmsd": null, "origin": [ 113.117, 110.891, 148.717 ], "x_axis": [ -0.117, -0.128, -0.985 ], "y_axis": [ 0.624, -0.781, 0.027 ], "z_axis": [ -0.773, -0.611, 0.172 ], "quaternion": [ -0.261, -0.611, -0.203, 0.719 ] } }, { "index": 26, "nt1": "///D/27", "nt2": "///D/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.143, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.731, "chi2": -161.187, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.103, "C1C1_dist": 10.797, "N1N9_dist": 9.000, "C6C8_dist": 9.886, "CNNC_torsion": -10.905, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 10.337, "planarity": 0.138, "simple_Shear": -0.187, "simple_Stretch": -0.123, "simple_Buckle": -3.368, "simple_Propeller": -9.773, "bp_simpleParams": [ -0.187, -0.123, 0.215, -3.368, -9.773, -1.782 ], "bp_params": [ -0.185, -0.126, 0.215, -3.230, -9.820, -1.788 ], "frame": { "rmsd": null, "origin": [ 109.566, 109.824, 148.359 ], "x_axis": [ 0.394, -0.364, -0.844 ], "y_axis": [ 0.559, -0.634, 0.534 ], "z_axis": [ -0.729, -0.682, -0.046 ], "quaternion": [ 0.422, 0.720, 0.068, -0.546 ] } }, { "index": 27, "nt1": "///D/28", "nt2": "///D/60", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.660, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.254, "chi2": -174.815, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.580, "C1C1_dist": 10.986, "N1N9_dist": 9.086, "C6C8_dist": 9.879, "CNNC_torsion": -12.078, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 8.737, "planarity": 0.131, "simple_Shear": -0.207, "simple_Stretch": -0.032, "simple_Buckle": -1.127, "simple_Propeller": -8.664, "bp_simpleParams": [ -0.207, -0.032, 0.332, -1.127, -8.664, -5.334 ], "bp_params": [ -0.206, -0.037, 0.332, -0.911, -8.690, -5.349 ], "frame": { "rmsd": null, "origin": [ 106.380, 108.252, 147.201 ], "x_axis": [ 0.705, -0.570, -0.422 ], "y_axis": [ 0.263, -0.343, 0.902 ], "z_axis": [ -0.659, -0.747, -0.092 ], "quaternion": [ 0.563, 0.731, -0.105, -0.370 ] } }, { "index": 28, "nt1": "///D/29", "nt2": "///D/59", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.806, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.359, "chi2": -150.086, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.166, "C1C1_dist": 10.558, "N1N9_dist": 8.880, "C6C8_dist": 9.818, "CNNC_torsion": -14.745, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[2.89]", "interBase_angle": 10.303, "planarity": 0.196, "simple_Shear": -0.020, "simple_Stretch": -0.107, "simple_Buckle": -6.244, "simple_Propeller": -8.196, "bp_simpleParams": [ -0.020, -0.107, 0.512, -6.244, -8.196, 0.440 ], "bp_params": [ -0.021, -0.107, 0.512, -6.285, -8.164, 0.440 ], "frame": { "rmsd": null, "origin": [ 104.816, 105.531, 144.803 ], "x_axis": [ 0.865, -0.494, 0.090 ], "y_axis": [ -0.133, -0.052, 0.990 ], "z_axis": [ -0.484, -0.868, -0.110 ], "quaternion": [ 0.652, 0.712, -0.220, -0.138 ] } }, { "index": 29, "nt1": "///D/30", "nt2": "///D/58", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.558, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 72.800, "chi2": -179.019, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 29.251, "C1C1_dist": 10.040, "N1N9_dist": 8.334, "C6C8_dist": 9.228, "CNNC_torsion": -17.619, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[3.44]", "interBase_angle": 26.542, "planarity": 0.351, "simple_Shear": 3.581, "simple_Stretch": -0.066, "simple_Buckle": -25.451, "simple_Propeller": -7.533, "bp_simpleParams": [ 3.581, -0.066, 1.573, -25.451, -7.533, 1.634 ], "bp_params": [ 3.314, -1.357, 1.573, -26.443, 2.293, 1.591 ], "frame": { "rmsd": null, "origin": [ 103.812, 101.470, 143.725 ], "x_axis": [ 0.497, -0.187, 0.847 ], "y_axis": [ -0.768, 0.359, 0.530 ], "z_axis": [ -0.404, -0.914, 0.035 ], "quaternion": [ 0.688, 0.525, -0.455, 0.211 ] } }, { "index": 30, "nt1": "///D/31", "nt2": "///D/55", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.674, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.559, "chi2": -167.695, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.577, "C1C1_dist": 11.005, "N1N9_dist": 9.049, "C6C8_dist": 9.789, "CNNC_torsion": -17.428, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[2.86]", "interBase_angle": 8.608, "planarity": 0.250, "simple_Shear": -0.246, "simple_Stretch": -0.166, "simple_Buckle": 3.760, "simple_Propeller": -7.743, "bp_simpleParams": [ -0.246, -0.166, 0.888, 3.760, -7.743, -8.468 ], "bp_params": [ -0.241, -0.173, 0.888, 3.987, -7.629, -8.482 ], "frame": { "rmsd": null, "origin": [ 104.942, 96.119, 146.495 ], "x_axis": [ 0.073, 0.491, 0.868 ], "y_axis": [ -0.747, 0.604, -0.279 ], "z_axis": [ -0.661, -0.628, 0.411 ], "quaternion": [ 0.722, 0.121, -0.529, 0.428 ] } }, { "index": 31, "nt1": "///D/32", "nt2": "///D/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.553, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.165, "chi2": 179.795, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.225, "C1C1_dist": 10.887, "N1N9_dist": 8.955, "C6C8_dist": 9.787, "CNNC_torsion": -12.970, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 5.834, "planarity": 0.189, "simple_Shear": 0.152, "simple_Stretch": -0.246, "simple_Buckle": 2.905, "simple_Propeller": -5.060, "bp_simpleParams": [ 0.152, -0.246, 0.702, 2.905, -5.060, -3.264 ], "bp_params": [ 0.150, -0.247, 0.702, 2.855, -5.088, -3.266 ], "frame": { "rmsd": null, "origin": [ 104.148, 93.223, 148.787 ], "x_axis": [ -0.354, 0.773, 0.527 ], "y_axis": [ -0.639, 0.211, -0.739 ], "z_axis": [ -0.682, -0.599, 0.419 ], "quaternion": [ 0.565, -0.062, -0.535, 0.625 ] } }, { "index": 32, "nt1": "///D/33", "nt2": "///D/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.828, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.086, "chi2": -164.976, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.652, "C1C1_dist": 10.527, "N1N9_dist": 8.760, "C6C8_dist": 9.754, "CNNC_torsion": -7.652, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 5.972, "planarity": 0.118, "simple_Shear": -0.039, "simple_Stretch": -0.178, "simple_Buckle": 4.320, "simple_Propeller": -4.123, "bp_simpleParams": [ -0.039, -0.178, 0.306, 4.320, -4.123, 2.794 ], "bp_params": [ -0.038, -0.179, 0.306, 4.359, -4.082, 2.794 ], "frame": { "rmsd": null, "origin": [ 102.489, 91.713, 151.908 ], "x_axis": [ -0.600, 0.799, 0.035 ], "y_axis": [ -0.373, -0.241, -0.896 ], "z_axis": [ -0.708, -0.550, 0.443 ], "quaternion": [ 0.388, -0.223, -0.479, 0.755 ] } }, { "index": 33, "nt1": "///D/69", "nt2": "///D/81", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -123.652, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.743, "chi2": -152.162, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 92.426, "C1C1_dist": 10.013, "N1N9_dist": 8.790, "C6C8_dist": 8.846, "CNNC_torsion": 179.875, "hbonds_num": 2, "hbonds_desc": "OP2-N2(amino)[2.92],N7-N2(amino)[3.34]", "interBase_angle": 9.323, "planarity": 0.108, "simple_Shear": -8.388, "simple_Stretch": 4.343, "simple_Buckle": 8.635, "simple_Propeller": 3.515, "bp_simpleParams": [ -8.388, 4.343, -0.025, 8.635, 3.515, -27.690 ], "bp_params": [ -7.790, -5.343, -0.025, 0.984, 9.271, -27.776 ], "frame": { "rmsd": null, "origin": [ 136.337, 122.126, 134.519 ], "x_axis": [ -0.185, 0.748, 0.637 ], "y_axis": [ -0.604, -0.598, 0.526 ], "z_axis": [ 0.775, -0.287, 0.563 ], "quaternion": [ 0.441, 0.461, 0.078, 0.766 ] } }, { "index": 34, "nt1": "///D/70", "nt2": "///D/80", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.771, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.561, "chi2": -168.650, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.551, "C1C1_dist": 10.916, "N1N9_dist": 9.039, "C6C8_dist": 9.897, "CNNC_torsion": -0.029, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 6.134, "planarity": 0.078, "simple_Shear": -0.208, "simple_Stretch": -0.076, "simple_Buckle": -6.045, "simple_Propeller": -1.043, "bp_simpleParams": [ -0.208, -0.076, -0.058, -6.045, -1.043, -0.974 ], "bp_params": [ -0.207, -0.079, -0.058, -6.028, -1.135, -0.972 ], "frame": { "rmsd": null, "origin": [ 137.786, 123.622, 139.789 ], "x_axis": [ -0.773, -0.015, 0.635 ], "y_axis": [ -0.159, -0.963, -0.216 ], "z_axis": [ 0.615, -0.268, 0.742 ], "quaternion": [ 0.039, 0.335, -0.130, 0.932 ] } }, { "index": 35, "nt1": "///D/71", "nt2": "///D/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.334, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.833, "chi2": -164.239, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.217, "C1C1_dist": 10.763, "N1N9_dist": 9.066, "C6C8_dist": 10.006, "CNNC_torsion": -1.580, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 3.244, "planarity": 0.036, "simple_Shear": -0.202, "simple_Stretch": 0.007, "simple_Buckle": -2.517, "simple_Propeller": -2.047, "bp_simpleParams": [ -0.202, 0.007, -0.060, -2.517, -2.047, 2.093 ], "bp_params": [ -0.202, 0.004, -0.060, -2.485, -2.085, 2.093 ], "frame": { "rmsd": null, "origin": [ 139.176, 124.788, 143.550 ], "x_axis": [ -0.793, -0.420, 0.441 ], "y_axis": [ 0.226, -0.875, -0.428 ], "z_axis": [ 0.566, -0.239, 0.789 ], "quaternion": [ -0.174, 0.271, -0.179, 0.930 ] } }, { "index": 36, "nt1": "///D/72", "nt2": "///D/78", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.792, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.915, "chi2": -174.177, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.108, "C1C1_dist": 11.316, "N1N9_dist": 9.562, "C6C8_dist": 10.432, "CNNC_torsion": 0.818, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.36],N3-N1(imino)[3.47],N4(amino)-O6(carbonyl)[3.38]", "interBase_angle": 2.089, "planarity": 0.072, "simple_Shear": -0.313, "simple_Stretch": 0.434, "simple_Buckle": 1.434, "simple_Propeller": -1.519, "bp_simpleParams": [ -0.313, 0.434, -0.377, 1.434, -1.519, -1.570 ], "bp_params": [ -0.329, 0.423, -0.377, 1.488, -1.466, -1.570 ], "frame": { "rmsd": null, "origin": [ 140.163, 125.975, 147.583 ], "x_axis": [ -0.604, -0.780, 0.164 ], "y_axis": [ 0.612, -0.585, -0.532 ], "z_axis": [ 0.511, -0.221, 0.831 ], "quaternion": [ -0.401, 0.194, -0.217, 0.869 ] } }, { "index": 37, "nt1": "///D/73", "nt2": "///D/76", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -117.765, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.482, "chi2": -79.538, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 55.039, "C1C1_dist": 10.955, "N1N9_dist": 9.454, "C6C8_dist": 10.473, "CNNC_torsion": 27.390, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.65]", "interBase_angle": 25.563, "planarity": 0.334, "simple_Shear": 0.328, "simple_Stretch": 0.613, "simple_Buckle": 17.722, "simple_Propeller": 18.422, "bp_simpleParams": [ 0.328, 0.613, -1.221, 17.722, 18.422, 2.536 ], "bp_params": [ 0.353, 0.599, -1.221, 18.455, 17.688, 2.535 ], "frame": { "rmsd": null, "origin": [ 141.099, 126.342, 151.313 ], "x_axis": [ -0.360, -0.933, 0.020 ], "y_axis": [ 0.821, -0.327, -0.468 ], "z_axis": [ 0.443, -0.152, 0.883 ], "quaternion": [ 0.547, -0.144, 0.193, -0.802 ] } }, { "index": 38, "nt1": "///D/87", "nt2": "///D/115", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW-.", "intra_chain": true, "chi1": -155.844, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.750, "chi2": -121.332, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 27.793, "C1C1_dist": 12.791, "N1N9_dist": 10.680, "C6C8_dist": 10.859, "CNNC_torsion": -5.670, "hbonds_num": 1, "hbonds_desc": "N1*O4(carbonyl)[2.98]", "interBase_angle": 10.823, "planarity": 0.119, "simple_Shear": 2.924, "simple_Stretch": 1.792, "simple_Buckle": -6.074, "simple_Propeller": -8.958, "bp_simpleParams": [ 2.924, 1.792, -0.144, -6.074, -8.958, -32.592 ], "bp_params": [ 3.335, 0.800, -0.144, -8.542, -6.646, -32.558 ], "frame": { "rmsd": null, "origin": [ 155.504, 128.646, 105.242 ], "x_axis": [ 0.089, 0.959, -0.269 ], "y_axis": [ -0.721, 0.248, 0.647 ], "z_axis": [ 0.688, 0.136, 0.713 ], "quaternion": [ 0.716, 0.179, 0.334, 0.587 ] } }, { "index": 39, "nt1": "///D/88", "nt2": "///D/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.281, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.133, "chi2": -149.038, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.264, "C1C1_dist": 10.839, "N1N9_dist": 8.923, "C6C8_dist": 9.669, "CNNC_torsion": -15.088, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.89]", "interBase_angle": 10.921, "planarity": 0.224, "simple_Shear": 0.202, "simple_Stretch": -0.268, "simple_Buckle": 10.859, "simple_Propeller": -1.170, "bp_simpleParams": [ 0.202, -0.268, 1.159, 10.859, -1.170, -8.243 ], "bp_params": [ 0.195, -0.272, 1.159, 10.827, -1.434, -8.207 ], "frame": { "rmsd": null, "origin": [ 158.324, 130.861, 106.468 ], "x_axis": [ -0.227, 0.974, 0.003 ], "y_axis": [ -0.825, -0.194, 0.531 ], "z_axis": [ 0.518, 0.118, 0.847 ], "quaternion": [ 0.597, 0.173, 0.216, 0.753 ] } }, { "index": 40, "nt1": "///D/89", "nt2": "///D/113", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.111, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.752, "chi2": -179.492, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.423, "C1C1_dist": 10.641, "N1N9_dist": 8.926, "C6C8_dist": 9.896, "CNNC_torsion": -9.206, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 12.098, "planarity": 0.162, "simple_Shear": 0.127, "simple_Stretch": -0.110, "simple_Buckle": 8.373, "simple_Propeller": -8.732, "bp_simpleParams": [ 0.127, -0.110, 0.179, 8.373, -8.732, 2.349 ], "bp_params": [ 0.127, -0.110, 0.179, 8.325, -8.778, 2.350 ], "frame": { "rmsd": null, "origin": [ 161.528, 132.959, 108.383 ], "x_axis": [ -0.642, 0.698, 0.317 ], "y_axis": [ -0.528, -0.702, 0.478 ], "z_axis": [ 0.556, 0.140, 0.819 ], "quaternion": [ 0.345, 0.246, 0.174, 0.889 ] } }, { "index": 41, "nt1": "///D/90", "nt2": "///D/112", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.139, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.239, "chi2": -163.869, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.001, "C1C1_dist": 11.267, "N1N9_dist": 9.704, "C6C8_dist": 10.686, "CNNC_torsion": 2.208, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.99],N1-N3(imino)[3.79]", "interBase_angle": 18.317, "planarity": 0.250, "simple_Shear": 0.445, "simple_Stretch": 0.762, "simple_Buckle": -13.291, "simple_Propeller": -12.603, "bp_simpleParams": [ 0.445, 0.762, -1.278, -13.291, -12.603, 5.243 ], "bp_params": [ 0.488, 0.735, -1.278, -13.991, -11.822, 5.232 ], "frame": { "rmsd": null, "origin": [ 163.737, 135.415, 111.133 ], "x_axis": [ -0.901, 0.089, 0.424 ], "y_axis": [ 0.075, -0.932, 0.355 ], "z_axis": [ 0.426, 0.352, 0.833 ], "quaternion": [ 0.004, 0.222, 0.185, 0.957 ] } }, { "index": 42, "nt1": "///D/91", "nt2": "///D/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.459, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.160, "chi2": -174.981, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.112, "C1C1_dist": 11.460, "N1N9_dist": 9.742, "C6C8_dist": 10.603, "CNNC_torsion": 9.191, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.90]", "interBase_angle": 8.049, "planarity": 0.201, "simple_Shear": 1.382, "simple_Stretch": 0.696, "simple_Buckle": -7.522, "simple_Propeller": 2.865, "bp_simpleParams": [ 1.382, 0.696, -0.659, -7.522, 2.865, -1.305 ], "bp_params": [ 1.462, 0.506, -0.659, -7.076, 3.836, -1.303 ], "frame": { "rmsd": null, "origin": [ 165.066, 138.279, 113.007 ], "x_axis": [ -0.701, -0.499, 0.510 ], "y_axis": [ 0.587, -0.810, 0.013 ], "z_axis": [ 0.406, 0.308, 0.860 ], "quaternion": [ -0.296, 0.249, 0.087, 0.918 ] } }, { "index": 43, "nt1": "///D/92", "nt2": "///D/110", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 173.903, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.671, "chi2": -171.140, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.760, "C1C1_dist": 11.557, "N1N9_dist": 9.839, "C6C8_dist": 10.811, "CNNC_torsion": 3.958, "hbonds_num": 1, "hbonds_desc": "N3-N2(amino)[3.72]", "interBase_angle": 19.005, "planarity": 0.340, "simple_Shear": -0.892, "simple_Stretch": 0.809, "simple_Buckle": -0.523, "simple_Propeller": 18.998, "bp_simpleParams": [ -0.892, 0.809, 1.165, -0.523, 18.998, 7.467 ], "bp_params": [ -0.966, 0.719, 1.165, -2.343, 18.860, 7.567 ], "frame": { "rmsd": null, "origin": [ 165.143, 141.011, 116.291 ], "x_axis": [ -0.581, -0.752, 0.311 ], "y_axis": [ 0.680, -0.658, -0.322 ], "z_axis": [ 0.447, 0.024, 0.894 ], "quaternion": [ -0.405, 0.214, -0.084, 0.885 ] } }, { "index": 44, "nt1": "///E/11", "nt2": "///G/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.266, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.307, "chi2": -73.456, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 55.028, "C1C1_dist": 10.143, "N1N9_dist": 8.487, "C6C8_dist": 9.489, "CNNC_torsion": 3.984, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 11.810, "planarity": 0.350, "simple_Shear": 0.052, "simple_Stretch": -0.567, "simple_Buckle": -0.086, "simple_Propeller": -11.810, "bp_simpleParams": [ 0.052, -0.567, -1.459, -0.086, -11.810, 5.420 ], "bp_params": [ 0.052, -0.567, -1.459, -0.088, -11.810, 5.449 ], "frame": { "rmsd": null, "origin": [ 125.349, 84.167, 100.112 ], "x_axis": [ 0.187, 0.366, -0.911 ], "y_axis": [ -0.971, 0.209, -0.116 ], "z_axis": [ 0.148, 0.907, 0.395 ], "quaternion": [ 0.669, -0.382, 0.396, 0.500 ] } }, { "index": 45, "nt1": "///E/12", "nt2": "///G/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.843, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.521, "chi2": -140.495, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.106, "C1C1_dist": 10.910, "N1N9_dist": 9.261, "C6C8_dist": 10.300, "CNNC_torsion": -9.419, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.32],O4(carbonyl)-N6(amino)[3.56]", "interBase_angle": 17.261, "planarity": 0.247, "simple_Shear": -0.260, "simple_Stretch": 0.351, "simple_Buckle": 6.131, "simple_Propeller": -16.136, "bp_simpleParams": [ -0.260, 0.351, -0.709, 6.131, -16.136, 5.107 ], "bp_params": [ -0.272, 0.342, -0.709, 6.660, -15.925, 5.148 ], "frame": { "rmsd": null, "origin": [ 124.753, 87.281, 101.940 ], "x_axis": [ -0.564, 0.353, -0.746 ], "y_axis": [ -0.820, -0.134, 0.556 ], "z_axis": [ 0.096, 0.926, 0.365 ], "quaternion": [ 0.408, -0.226, 0.516, 0.718 ] } }, { "index": 46, "nt1": "///E/13", "nt2": "///G/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.593, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.386, "chi2": -102.947, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.309, "C1C1_dist": 10.453, "N1N9_dist": 8.808, "C6C8_dist": 9.838, "CNNC_torsion": -7.722, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 13.577, "planarity": 0.177, "simple_Shear": -0.111, "simple_Stretch": -0.103, "simple_Buckle": 5.157, "simple_Propeller": -12.559, "bp_simpleParams": [ -0.111, -0.103, -0.242, 5.157, -12.559, 3.520 ], "bp_params": [ -0.109, -0.105, -0.242, 5.369, -12.470, 3.537 ], "frame": { "rmsd": null, "origin": [ 124.999, 90.634, 102.723 ], "x_axis": [ -0.910, 0.166, -0.379 ], "y_axis": [ -0.413, -0.323, 0.851 ], "z_axis": [ 0.019, 0.932, 0.363 ], "quaternion": [ 0.180, -0.112, 0.553, 0.806 ] } }, { "index": 47, "nt1": "///E/14", "nt2": "///G/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.217, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.876, "chi2": -106.276, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.301, "C1C1_dist": 10.500, "N1N9_dist": 8.836, "C6C8_dist": 9.838, "CNNC_torsion": -14.560, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 14.013, "planarity": 0.176, "simple_Shear": 0.111, "simple_Stretch": -0.169, "simple_Buckle": 4.769, "simple_Propeller": -13.176, "bp_simpleParams": [ 0.111, -0.169, 0.162, 4.769, -13.176, 2.375 ], "bp_params": [ 0.110, -0.169, 0.162, 4.688, -13.205, 2.389 ], "frame": { "rmsd": null, "origin": [ 125.067, 93.577, 104.750 ], "x_axis": [ -0.960, -0.075, 0.268 ], "y_axis": [ 0.275, -0.412, 0.869 ], "z_axis": [ 0.045, 0.908, 0.417 ], "quaternion": [ -0.105, 0.094, 0.532, 0.835 ] } }, { "index": 48, "nt1": "///E/15", "nt2": "///G/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.468, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.186, "chi2": -137.926, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.924, "C1C1_dist": 10.348, "N1N9_dist": 8.901, "C6C8_dist": 10.169, "CNNC_torsion": -24.207, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.17]", "interBase_angle": 21.536, "planarity": 0.301, "simple_Shear": -0.221, "simple_Stretch": 0.296, "simple_Buckle": 3.132, "simple_Propeller": -21.307, "bp_simpleParams": [ -0.221, 0.296, 0.818, 3.132, -21.307, 13.693 ], "bp_params": [ -0.226, 0.292, 0.818, 3.496, -21.250, 13.923 ], "frame": { "rmsd": null, "origin": [ 124.658, 96.604, 106.181 ], "x_axis": [ -0.617, -0.358, 0.701 ], "y_axis": [ 0.786, -0.329, 0.524 ], "z_axis": [ 0.043, 0.874, 0.484 ], "quaternion": [ -0.367, 0.239, 0.448, 0.779 ] } }, { "index": 49, "nt1": "///E/16", "nt2": "///G/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.417, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.484, "chi2": -127.046, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.369, "C1C1_dist": 11.385, "N1N9_dist": 9.628, "C6C8_dist": 10.575, "CNNC_torsion": -20.250, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.62],O4(carbonyl)-N6(amino)[3.89]", "interBase_angle": 25.081, "planarity": 0.315, "simple_Shear": -0.054, "simple_Stretch": 0.642, "simple_Buckle": -3.609, "simple_Propeller": -24.820, "bp_simpleParams": [ -0.054, 0.642, 0.289, -3.609, -24.820, -0.141 ], "bp_params": [ -0.058, 0.642, 0.289, -3.396, -24.850, -0.144 ], "frame": { "rmsd": null, "origin": [ 124.687, 100.148, 107.012 ], "x_axis": [ -0.073, -0.444, 0.893 ], "y_axis": [ 0.997, -0.063, 0.051 ], "z_axis": [ 0.033, 0.894, 0.448 ], "quaternion": [ 0.573, -0.368, -0.375, -0.629 ] } }, { "index": 50, "nt1": "///E/17", "nt2": "///G/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.902, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.991, "chi2": -102.027, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.119, "C1C1_dist": 11.341, "N1N9_dist": 9.668, "C6C8_dist": 10.703, "CNNC_torsion": -18.245, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.75]", "interBase_angle": 23.164, "planarity": 0.298, "simple_Shear": 0.042, "simple_Stretch": 0.776, "simple_Buckle": -3.928, "simple_Propeller": -22.828, "bp_simpleParams": [ 0.042, 0.776, -0.262, -3.928, -22.828, 4.982 ], "bp_params": [ 0.045, 0.776, -0.262, -3.949, -22.824, 5.080 ], "frame": { "rmsd": null, "origin": [ 124.002, 103.117, 108.311 ], "x_axis": [ 0.527, -0.369, 0.766 ], "y_axis": [ 0.848, 0.289, -0.444 ], "z_axis": [ -0.058, 0.883, 0.465 ], "quaternion": [ 0.755, -0.439, -0.273, -0.403 ] } }, { "index": 51, "nt1": "///E/18", "nt2": "///G/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.612, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.113, "chi2": -99.917, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.513, "C1C1_dist": 10.467, "N1N9_dist": 8.812, "C6C8_dist": 9.835, "CNNC_torsion": -16.641, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.13]", "interBase_angle": 21.097, "planarity": 0.287, "simple_Shear": 0.039, "simple_Stretch": -0.098, "simple_Buckle": -3.722, "simple_Propeller": -20.766, "bp_simpleParams": [ 0.039, -0.098, -0.419, -3.722, -20.766, 4.673 ], "bp_params": [ 0.039, -0.098, -0.419, -3.727, -20.765, 4.748 ], "frame": { "rmsd": null, "origin": [ 123.613, 106.077, 109.689 ], "x_axis": [ 0.920, -0.217, 0.327 ], "y_axis": [ 0.392, 0.478, -0.786 ], "z_axis": [ 0.015, 0.851, 0.525 ], "quaternion": [ 0.855, -0.479, -0.091, -0.178 ] } }, { "index": 52, "nt1": "///E/19", "nt2": "///G/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -71.117, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.974, "chi2": -114.101, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.877, "C1C1_dist": 10.583, "N1N9_dist": 8.846, "C6C8_dist": 9.765, "CNNC_torsion": -8.709, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 18.761, "planarity": 0.268, "simple_Shear": -0.012, "simple_Stretch": -0.165, "simple_Buckle": -7.324, "simple_Propeller": -17.273, "bp_simpleParams": [ -0.012, -0.165, -0.502, -7.324, -17.273, 0.164 ], "bp_params": [ -0.012, -0.165, -0.502, -7.273, -17.294, 0.166 ], "frame": { "rmsd": null, "origin": [ 123.537, 109.270, 111.248 ], "x_axis": [ 0.946, 0.168, -0.277 ], "y_axis": [ -0.324, 0.524, -0.788 ], "z_axis": [ 0.013, 0.835, 0.550 ], "quaternion": [ 0.869, -0.467, 0.083, 0.142 ] } }, { "index": 53, "nt1": "///E/20", "nt2": "///G/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -71.655, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.790, "chi2": -78.175, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.524, "C1C1_dist": 10.811, "N1N9_dist": 8.987, "C6C8_dist": 9.850, "CNNC_torsion": 5.488, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 9.332, "planarity": 0.216, "simple_Shear": 0.180, "simple_Stretch": -0.138, "simple_Buckle": -9.088, "simple_Propeller": -2.121, "bp_simpleParams": [ 0.180, -0.138, -0.472, -9.088, -2.121, -1.586 ], "bp_params": [ 0.178, -0.140, -0.472, -9.118, -1.987, -1.581 ], "frame": { "rmsd": null, "origin": [ 122.690, 113.212, 111.715 ], "x_axis": [ 0.545, 0.475, -0.691 ], "y_axis": [ -0.837, 0.258, -0.482 ], "z_axis": [ -0.051, 0.841, 0.538 ], "quaternion": [ 0.765, -0.432, 0.209, 0.429 ] } }, { "index": 54, "nt1": "///E/21", "nt2": "///G/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.419, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.805, "chi2": -101.559, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.656, "C1C1_dist": 11.061, "N1N9_dist": 9.376, "C6C8_dist": 10.374, "CNNC_torsion": -11.687, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.44],O4(carbonyl)-N6(amino)[3.68]", "interBase_angle": 8.154, "planarity": 0.106, "simple_Shear": 0.222, "simple_Stretch": 0.452, "simple_Buckle": -2.876, "simple_Propeller": -7.630, "bp_simpleParams": [ 0.222, 0.452, 0.029, -2.876, -7.630, 2.203 ], "bp_params": [ 0.230, 0.447, 0.029, -3.017, -7.575, 2.207 ], "frame": { "rmsd": null, "origin": [ 121.717, 115.871, 113.876 ], "x_axis": [ 0.086, 0.451, -0.888 ], "y_axis": [ -0.990, -0.058, -0.126 ], "z_axis": [ -0.108, 0.891, 0.442 ], "quaternion": [ 0.606, -0.419, 0.322, 0.594 ] } }, { "index": 55, "nt1": "///E/22", "nt2": "///G/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.061, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.719, "chi2": -95.384, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.314, "C1C1_dist": 10.563, "N1N9_dist": 8.919, "C6C8_dist": 9.930, "CNNC_torsion": -1.007, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 4.596, "planarity": 0.056, "simple_Shear": -0.204, "simple_Stretch": -0.078, "simple_Buckle": -1.766, "simple_Propeller": -4.243, "bp_simpleParams": [ -0.204, -0.078, -0.119, -1.766, -4.243, 3.495 ], "bp_params": [ -0.203, -0.081, -0.119, -1.698, -4.271, 3.497 ], "frame": { "rmsd": null, "origin": [ 120.461, 119.075, 114.494 ], "x_axis": [ -0.505, 0.218, -0.835 ], "y_axis": [ -0.860, -0.207, 0.466 ], "z_axis": [ -0.072, 0.954, 0.292 ], "quaternion": [ 0.381, -0.320, 0.501, 0.708 ] } }, { "index": 56, "nt1": "///E/23", "nt2": "///G/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.853, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.361, "chi2": -82.030, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.279, "C1C1_dist": 10.461, "N1N9_dist": 8.821, "C6C8_dist": 9.826, "CNNC_torsion": -1.448, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 3.595, "planarity": 0.039, "simple_Shear": 0.155, "simple_Stretch": -0.179, "simple_Buckle": 2.750, "simple_Propeller": -2.315, "bp_simpleParams": [ 0.155, -0.179, -0.083, 2.750, -2.315, 2.990 ], "bp_params": [ 0.153, -0.180, -0.083, 2.725, -2.346, 2.989 ], "frame": { "rmsd": null, "origin": [ 120.035, 122.155, 116.550 ], "x_axis": [ -0.888, 0.037, -0.458 ], "y_axis": [ -0.449, -0.283, 0.847 ], "z_axis": [ -0.098, 0.959, 0.268 ], "quaternion": [ 0.156, -0.178, 0.578, 0.781 ] } } ], "num_helices": 4, "helices": [ { "index": 1, "num_stems": 3, "strand1": "UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU", "strand2": "AACGCAACTATTTTCATAAUAGAAACAUCAGA", "bp_type": "||||||||||||||||||||||||||||.|||", "helix_form": "AAA..A.AAAA..A....x...AAAAA.xAA", "helical_rise": 3.064, "helical_rise_std": 1.394, "helical_radius": 10.516, "helical_radius_std": 4.081, "helical_axis": [ -0.410, -0.879, 0.245 ], "point1": [ 138.093, 175.150, 126.122 ], "point2": [ 98.953, 91.158, 149.506 ], "num_pairs": 32, "pairs": [ { "index": 1, "nt1": "///D/2", "nt2": "///E/42", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.103, -0.280, 0.781, 4.110, 16.236, -0.753 ], "step_params": [ 0.115, -2.189, 4.164, 6.457, 21.994, 33.000 ], "heli_params": [ -5.963, 0.643, 2.306, 34.083, -10.006, 39.997 ], "bp2_params": [ -0.037, 0.025, -0.025, -5.232, -0.090, -4.465 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.164, "simple_Twist": 33.046, "simple_hRise": 2.308, "simple_hTwist": 40.034 }, { "index": 2, "nt1": "///D/3", "nt2": "///E/41", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.037, 0.025, -0.025, -5.232, -0.090, -4.465 ], "step_params": [ -0.070, -1.769, 3.328, -3.638, 14.182, 23.516 ], "heli_params": [ -6.718, -0.627, 1.953, 31.219, 8.007, 27.647 ], "bp2_params": [ -0.161, -0.175, 0.366, -2.090, 5.567, -0.711 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.328, "simple_Twist": 23.994, "simple_hRise": 1.982, "simple_hTwist": 28.053 }, { "index": 3, "nt1": "///D/4", "nt2": "///E/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.161, -0.175, 0.366, -2.090, 5.567, -0.711 ], "step_params": [ 0.346, -1.589, 3.344, 1.572, 8.629, 37.705 ], "heli_params": [ -3.431, -0.335, 2.935, 13.134, -2.393, 38.676 ], "bp2_params": [ 0.157, -0.108, 0.312, 2.673, 2.317, -1.352 ], "groove_widths": [ 19.050, null, 19.512, null ], "simple_Rise": 3.344, "simple_Twist": 36.224, "simple_hRise": 2.915, "simple_hTwist": 37.236 }, { "index": 4, "nt1": "///D/5", "nt2": "///E/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.108, 0.312, 2.673, 2.317, -1.352 ], "step_params": [ -0.166, -1.779, 3.294, -0.340, 20.552, 25.855 ], "heli_params": [ -6.046, 0.245, 1.510, 39.019, 0.646, 32.920 ], "bp2_params": [ -0.264, -0.045, 0.063, -6.119, -6.128, 4.192 ], "groove_widths": [ 18.561, 16.386, 16.720, 11.265 ], "simple_Rise": 3.294, "simple_Twist": 27.438, "simple_hRise": 1.611, "simple_hTwist": 34.164 }, { "index": 5, "nt1": "///D/6", "nt2": "///E/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.045, 0.063, -6.119, -6.128, 4.192 ], "step_params": [ -0.737, -1.408, 3.410, 0.775, 5.647, 33.906 ], "heli_params": [ -3.271, 1.369, 3.125, 9.599, -1.317, 34.368 ], "bp2_params": [ -0.130, -0.017, -0.123, -5.349, 2.300, -7.956 ], "groove_widths": [ 17.730, 15.607, 16.464, 11.929 ], "simple_Rise": 3.410, "simple_Twist": 33.085, "simple_hRise": 3.117, "simple_hTwist": 33.559 }, { "index": 6, "nt1": "///D/7", "nt2": "///E/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.017, -0.123, -5.349, 2.300, -7.956 ], "step_params": [ 0.217, -1.490, 3.194, 2.670, 13.844, 30.168 ], "heli_params": [ -4.659, 0.017, 2.317, 24.957, -4.813, 33.230 ], "bp2_params": [ 0.023, -0.116, -0.021, 10.768, 5.313, -2.298 ], "groove_widths": [ 16.830, 14.903, 16.581, 12.810 ], "simple_Rise": 3.194, "simple_Twist": 29.756, "simple_hRise": 2.303, "simple_hTwist": 32.859 }, { "index": 7, "nt1": "///D/8", "nt2": "///E/36", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.023, -0.116, -0.021, 10.768, 5.313, -2.298 ], "step_params": [ -0.389, -1.427, 3.611, -3.507, 9.084, 31.966 ], "heli_params": [ -4.071, 0.064, 3.124, 16.036, 6.191, 33.380 ], "bp2_params": [ -0.198, -0.176, 0.225, -5.035, -14.694, -2.680 ], "groove_widths": [ 16.846, 15.638, 17.397, 15.550 ], "simple_Rise": 3.611, "simple_Twist": 32.834, "simple_hRise": 3.140, "simple_hTwist": 34.210 }, { "index": 8, "nt1": "///D/9", "nt2": "///E/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.176, 0.225, -5.035, -14.694, -2.680 ], "step_params": [ -0.256, -1.029, 3.453, -0.742, -0.648, 36.158 ], "heli_params": [ -1.560, 0.302, 3.475, -1.043, 1.196, 36.171 ], "bp2_params": [ 0.617, 0.515, 0.157, -5.564, -14.829, 2.392 ], "groove_widths": [ 16.985, 16.162, 18.409, 17.050 ], "simple_Rise": 3.453, "simple_Twist": 32.220, "simple_hRise": 3.478, "simple_hTwist": 32.235 }, { "index": 9, "nt1": "///D/10", "nt2": "///E/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.617, 0.515, 0.157, -5.564, -14.829, 2.392 ], "step_params": [ 0.405, -1.822, 3.363, -0.123, 1.443, 23.806 ], "heli_params": [ -4.888, -1.021, 3.246, 3.495, 0.297, 23.849 ], "bp2_params": [ -0.036, -0.020, 0.182, 0.033, -11.256, 2.185 ], "groove_widths": [ 16.788, 15.825, 19.682, 19.085 ], "simple_Rise": 3.363, "simple_Twist": 27.338, "simple_hRise": 3.262, "simple_hTwist": 27.376 }, { "index": 10, "nt1": "///D/11", "nt2": "///E/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.036, -0.020, 0.182, 0.033, -11.256, 2.185 ], "step_params": [ -0.346, -1.464, 3.400, -0.975, 8.002, 31.638 ], "heli_params": [ -3.980, 0.448, 2.960, 14.387, 1.752, 32.623 ], "bp2_params": [ 0.136, -0.083, 0.118, -3.141, -10.007, -0.589 ], "groove_widths": [ 17.047, 15.968, 17.861, 17.554 ], "simple_Rise": 3.400, "simple_Twist": 30.449, "simple_hRise": 2.939, "simple_hTwist": 31.474 }, { "index": 11, "nt1": "///D/12", "nt2": "///E/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, -0.083, 0.118, -3.141, -10.007, -0.589 ], "step_params": [ -0.298, -1.098, 3.467, -0.026, 3.703, 33.604 ], "heli_params": [ -2.512, 0.508, 3.331, 6.381, 0.044, 33.802 ], "bp2_params": [ -0.000, -0.026, -0.108, -2.123, -5.847, -0.664 ], "groove_widths": [ 17.560, 16.402, 18.889, 18.554 ], "simple_Rise": 3.467, "simple_Twist": 34.325, "simple_hRise": 3.334, "simple_hTwist": 34.518 }, { "index": 12, "nt1": "///D/13", "nt2": "///E/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.000, -0.026, -0.108, -2.123, -5.847, -0.664 ], "step_params": [ 0.986, -1.626, 3.634, 0.904, 3.371, 23.069 ], "heli_params": [ -5.269, -2.105, 3.400, 8.368, -2.245, 23.328 ], "bp2_params": [ -0.667, 0.716, -0.250, -1.248, -2.044, 11.154 ], "groove_widths": [ 17.625, 16.336, 19.469, 19.043 ], "simple_Rise": 3.634, "simple_Twist": 26.995, "simple_hRise": 3.440, "simple_hTwist": 27.216 }, { "index": 13, "nt1": "///D/14", "nt2": "///E/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.667, 0.716, -0.250, -1.248, -2.044, 11.154 ], "step_params": [ -0.618, -2.054, 3.563, -2.356, 6.516, 28.248 ], "heli_params": [ -5.562, 0.699, 3.062, 13.103, 4.737, 29.069 ], "bp2_params": [ 0.133, 0.024, -0.133, -0.665, -5.077, 0.519 ], "groove_widths": [ 17.505, 16.073, 22.008, 21.432 ], "simple_Rise": 3.563, "simple_Twist": 23.755, "simple_hRise": 2.949, "simple_hTwist": 24.731 }, { "index": 14, "nt1": "///D/15", "nt2": "///E/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, 0.024, -0.133, -0.665, -5.077, 0.519 ], "step_params": [ -0.152, -2.250, 3.738, 1.989, 7.452, 29.030 ], "heli_params": [ -5.966, 0.725, 3.061, 14.545, -3.882, 30.016 ], "bp2_params": [ -0.217, -0.065, -0.430, -4.498, -5.249, -0.369 ], "groove_widths": [ 17.475, 15.964, 22.346, 21.892 ], "simple_Rise": 3.738, "simple_Twist": 30.540, "simple_hRise": 3.100, "simple_hTwist": 31.476 }, { "index": 15, "nt1": "///D/16", "nt2": "///E/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.217, -0.065, -0.430, -4.498, -5.249, -0.369 ], "step_params": [ 0.947, -2.551, 3.393, -1.012, 3.520, 18.918 ], "heli_params": [ -9.317, -3.319, 2.822, 10.581, 3.043, 19.266 ], "bp2_params": [ -0.251, 0.520, -0.056, 3.896, -7.523, 9.140 ], "groove_widths": [ 17.124, 15.519, 21.101, 21.078 ], "simple_Rise": 3.393, "simple_Twist": 19.478, "simple_hRise": 2.839, "simple_hTwist": 19.816 }, { "index": 16, "nt1": "///D/17", "nt2": "///E/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.251, 0.520, -0.056, 3.896, -7.523, 9.140 ], "step_params": [ 0.881, -1.491, 3.536, 3.921, 8.571, 30.358 ], "heli_params": [ -4.357, -0.864, 3.098, 15.892, -7.271, 31.755 ], "bp2_params": [ -1.275, 0.399, 0.060, -6.756, -20.780, 19.466 ], "groove_widths": [ 16.736, 15.221, 23.221, 23.125 ], "simple_Rise": 3.536, "simple_Twist": 35.687, "simple_hRise": 3.182, "simple_hTwist": 36.872 }, { "index": 17, "nt1": "///D/18", "nt2": "///E/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.275, 0.399, 0.060, -6.756, -20.780, 19.466 ], "step_params": [ -0.180, -0.777, 3.483, 1.501, 1.169, 34.408 ], "heli_params": [ -1.504, 0.551, 3.445, 1.975, -2.534, 34.459 ], "bp2_params": [ -0.283, 0.714, -0.100, -0.892, -15.459, 10.257 ], "groove_widths": [ 16.249, 14.982, 26.538, 25.439 ], "simple_Rise": 3.483, "simple_Twist": 29.508, "simple_hRise": 3.437, "simple_hTwist": 29.568 }, { "index": 18, "nt1": "///D/19", "nt2": "///E/25", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.283, 0.714, -0.100, -0.892, -15.459, 10.257 ], "step_params": [ 0.693, -2.308, 3.644, -1.405, -8.034, 22.440 ], "heli_params": [ -2.350, -2.241, 4.157, -19.823, 3.467, 23.859 ], "bp2_params": [ 0.618, 0.714, -0.313, 7.635, 4.287, 10.166 ], "groove_widths": [ 15.666, 14.124, 16.749, 16.682 ], "simple_Rise": 3.644, "simple_Twist": 17.453, "simple_hRise": 4.212, "simple_hTwist": 19.251 }, { "index": 19, "nt1": "///D/20", "nt2": "///E/24", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.618, 0.714, -0.313, 7.635, 4.287, 10.166 ], "step_params": [ 3.401, -1.171, 3.158, -7.049, 6.608, 58.751 ], "heli_params": [ -1.478, -3.746, 2.638, 6.686, 7.132, 59.470 ], "bp2_params": [ -2.336, -0.474, 0.373, 3.501, -6.074, -7.179 ], "groove_widths": [ 15.591, 12.706, 17.067, 16.680 ], "simple_Rise": 3.158, "simple_Twist": 74.003, "simple_hRise": 2.774, "simple_hTwist": 74.542 }, { "index": 20, "nt1": "///D/21", "nt2": "///D/67", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.336, -0.474, 0.373, 3.501, -6.074, -7.179 ], "step_params": [ -0.537, -1.545, 3.665, -4.207, 8.104, 38.893 ], "heli_params": [ -3.277, 0.262, 3.329, 11.971, 6.214, 39.910 ], "bp2_params": [ -0.151, 0.018, -0.016, 1.773, -3.988, -2.110 ], "groove_widths": [ 16.612, 11.616, 15.191, 13.587 ], "simple_Rise": 3.665, "simple_Twist": 27.440, "simple_hRise": 3.137, "simple_hTwist": 28.892 }, { "index": 21, "nt1": "///D/22", "nt2": "///D/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, 0.018, -0.016, 1.773, -3.988, -2.110 ], "step_params": [ 0.084, -1.486, 3.419, -0.898, 9.641, 38.978 ], "heli_params": [ -3.259, -0.224, 2.981, 14.184, 1.321, 40.117 ], "bp2_params": [ 2.051, -0.267, 0.155, 2.165, -5.900, 0.357 ], "groove_widths": [ 17.558, 14.313, 15.087, 9.979 ], "simple_Rise": 3.419, "simple_Twist": 27.137, "simple_hRise": 2.737, "simple_hTwist": 28.782 }, { "index": 22, "nt1": "///D/23", "nt2": "///D/65", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.051, -0.267, 0.155, 2.165, -5.900, 0.357 ], "step_params": [ -0.629, -2.215, 3.170, -1.658, 10.558, 25.043 ], "heli_params": [ -6.944, 0.986, 2.115, 23.055, 3.621, 27.195 ], "bp2_params": [ -0.134, -0.056, 0.441, -1.141, -11.716, -2.511 ], "groove_widths": [ 17.554, 16.539, 15.336, 10.147 ], "simple_Rise": 3.170, "simple_Twist": 36.820, "simple_hRise": 2.490, "simple_hTwist": 38.289 }, { "index": 23, "nt1": "///D/24", "nt2": "///D/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.134, -0.056, 0.441, -1.141, -11.716, -2.511 ], "step_params": [ -0.262, -1.328, 3.286, 0.827, 7.634, 33.510 ], "heli_params": [ -3.395, 0.568, 2.915, 13.029, -1.411, 34.354 ], "bp2_params": [ -0.067, 0.009, 0.165, -1.724, -12.375, -4.961 ], "groove_widths": [ 17.426, 15.911, 15.555, 12.138 ], "simple_Rise": 3.286, "simple_Twist": 33.569, "simple_hRise": 2.916, "simple_hTwist": 34.412 }, { "index": 24, "nt1": "///D/25", "nt2": "///D/63", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.067, 0.009, 0.165, -1.724, -12.375, -4.961 ], "step_params": [ 0.527, -1.540, 3.264, 1.660, 4.305, 32.819 ], "heli_params": [ -3.404, -0.653, 3.065, 7.572, -2.920, 33.133 ], "bp2_params": [ 0.040, 0.030, 0.006, 0.507, -10.242, -1.562 ], "groove_widths": [ 17.455, 16.034, 15.588, 12.682 ], "simple_Rise": 3.264, "simple_Twist": 32.189, "simple_hRise": 3.061, "simple_hTwist": 32.509 }, { "index": 25, "nt1": "///D/26", "nt2": "///D/62", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, 0.030, 0.006, 0.507, -10.242, -1.562 ], "step_params": [ 0.109, -1.609, 3.358, -0.901, 13.356, 31.038 ], "heli_params": [ -4.791, -0.325, 2.472, 23.629, 1.595, 33.736 ], "bp2_params": [ -0.185, -0.126, 0.215, -3.230, -9.820, -1.788 ], "groove_widths": [ 17.713, 16.298, 16.903, 13.946 ], "simple_Rise": 3.358, "simple_Twist": 31.935, "simple_hRise": 2.502, "simple_hTwist": 34.559 }, { "index": 26, "nt1": "///D/27", "nt2": "///D/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.126, 0.215, -3.230, -9.820, -1.788 ], "step_params": [ -0.281, -1.480, 3.420, -1.637, 5.834, 32.212 ], "heli_params": [ -3.637, 0.214, 3.121, 10.401, 2.917, 32.762 ], "bp2_params": [ -0.206, -0.037, 0.332, -0.911, -8.690, -5.349 ], "groove_widths": [ 17.917, 16.380, 17.317, 12.019 ], "simple_Rise": 3.420, "simple_Twist": 32.685, "simple_hRise": 3.126, "simple_hTwist": 33.227 }, { "index": 27, "nt1": "///D/28", "nt2": "///D/60", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.037, 0.332, -0.911, -8.690, -5.349 ], "step_params": [ 0.649, -1.985, 3.352, -1.064, 12.205, 29.071 ], "heli_params": [ -5.718, -1.376, 2.325, 23.064, 2.012, 31.495 ], "bp2_params": [ -0.021, -0.107, 0.512, -6.285, -8.164, 0.440 ], "groove_widths": [ 18.086, 15.899, 15.642, 10.459 ], "simple_Rise": 3.352, "simple_Twist": 27.538, "simple_hRise": 2.261, "simple_hTwist": 30.092 }, { "index": 28, "nt1": "///D/29", "nt2": "///D/59", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.107, 0.512, -6.285, -8.164, 0.440 ], "step_params": [ 0.292, -1.265, 4.121, -4.297, 8.923, 52.536 ], "heli_params": [ -2.101, -0.658, 3.841, 9.979, 4.806, 53.396 ], "bp2_params": [ 3.314, -1.357, 1.573, -26.443, 2.293, 1.591 ], "groove_widths": [ 18.789, 15.696, 13.206, 12.823 ], "simple_Rise": 4.121, "simple_Twist": 33.624, "simple_hRise": 3.614, "simple_hTwist": 35.012 }, { "index": 29, "nt1": "///D/30", "nt2": "///D/58", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.314, -1.357, 1.573, -26.443, 2.293, 1.591 ], "step_params": [ 2.379, -3.663, 4.301, -24.715, 19.032, 44.533 ], "heli_params": [ -5.174, -4.097, 1.334, 22.196, 28.824, 53.913 ], "bp2_params": [ -0.241, -0.173, 0.888, 3.987, -7.629, -8.482 ], "groove_widths": [ 20.509, null, 13.305, null ], "simple_Rise": 4.301, "simple_Twist": 64.612, "simple_hRise": 2.346, "simple_hTwist": 71.007 }, { "index": 30, "nt1": "///D/31", "nt2": "///D/55", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.173, 0.888, 3.987, -7.629, -8.482 ], "step_params": [ -0.113, -1.903, 3.262, -1.374, 1.657, 35.773 ], "heli_params": [ -3.327, -0.010, 3.175, 2.694, 2.234, 35.836 ], "bp2_params": [ 0.150, -0.247, 0.702, 2.855, -5.088, -3.266 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.262, "simple_Twist": 34.143, "simple_hRise": 3.171, "simple_hTwist": 34.209 }, { "index": 31, "nt1": "///D/32", "nt2": "///D/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.247, 0.702, 2.855, -5.088, -3.266 ], "step_params": [ 0.498, -1.785, 3.367, 0.425, 3.381, 31.765 ], "heli_params": [ -3.858, -0.827, 3.171, 6.155, -0.774, 31.943 ], "bp2_params": [ -0.038, -0.179, 0.306, 4.359, -4.082, 2.794 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.367, "simple_Twist": 32.328, "simple_hRise": 3.175, "simple_hTwist": 32.503 }, { "index": 32, "nt1": "///D/33", "nt2": "///D/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "AGGCU", "strand2": "GCCGA", "bp_type": ".||||", "helix_form": ".AAx", "helical_rise": 3.417, "helical_rise_std": 0.318, "helical_radius": 11.966, "helical_radius_std": 1.500, "helical_axis": [ 0.512, -0.414, 0.753 ], "point1": [ 129.037, 125.119, 141.034 ], "point2": [ 136.017, 119.468, 151.308 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///D/69", "nt2": "///D/81", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.790, -5.343, -0.025, 0.984, 9.271, -27.776 ], "step_params": [ 3.748, -1.262, 4.059, -4.872, 12.959, 56.238 ], "heli_params": [ -2.111, -4.182, 3.409, 13.521, 5.084, 57.782 ], "bp2_params": [ -0.207, -0.079, -0.058, -6.028, -1.135, -0.972 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.059, "simple_Twist": 5.788, "simple_hRise": -0.736, "simple_hTwist": 15.000 }, { "index": 2, "nt1": "///D/70", "nt2": "///D/80", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.079, -0.058, -6.028, -1.135, -0.972 ], "step_params": [ 0.683, -2.319, 3.404, 2.555, 3.349, 25.794 ], "heli_params": [ -6.046, -0.810, 3.135, 7.438, -5.674, 26.130 ], "bp2_params": [ -0.202, 0.004, -0.060, -2.485, -2.085, 2.093 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.404, "simple_Twist": 26.153, "simple_hRise": 3.139, "simple_hTwist": 26.485 }, { "index": 3, "nt1": "///D/71", "nt2": "///D/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.202, 0.004, -0.060, -2.485, -2.085, 2.093 ], "step_params": [ -0.212, -2.484, 3.527, 3.350, 2.374, 28.410 ], "heli_params": [ -5.569, 1.215, 3.267, 4.805, -6.781, 28.699 ], "bp2_params": [ -0.329, 0.423, -0.377, 1.488, -1.466, -1.570 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.527, "simple_Twist": 28.931, "simple_hRise": 3.272, "simple_hTwist": 29.215 }, { "index": 4, "nt1": "///D/72", "nt2": "///D/78", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.329, 0.423, -0.377, 1.488, -1.466, -1.570 ], "step_params": [ -0.460, -1.376, 3.579, 6.185, -1.240, 18.456 ], "heli_params": [ -3.402, 4.655, 3.332, -3.729, -18.593, 19.496 ], "bp2_params": [ 0.353, 0.599, -1.221, 18.455, 17.688, 2.535 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.579, "simple_Twist": 14.159, "simple_hRise": 3.200, "simple_hTwist": 15.494 }, { "index": 5, "nt1": "///D/73", "nt2": "///D/76", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "AACACC", "strand2": "UUGUGG", "bp_type": ".|||||", "helix_form": ".....", "helical_rise": 3.019, "helical_rise_std": 0.469, "helical_radius": 10.135, "helical_radius_std": 1.514, "helical_axis": [ 0.453, 0.052, 0.890 ], "point1": [ 155.047, 135.043, 104.809 ], "point2": [ 161.866, 135.827, 118.191 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///D/87", "nt2": "///D/115", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW-.", "bp1_params": [ 3.335, 0.800, -0.144, -8.542, -6.646, -32.558 ], "step_params": [ 1.891, -1.431, 2.956, -12.379, -1.374, 24.158 ], "heli_params": [ -2.779, -6.467, 1.858, -3.038, 27.372, 27.137 ], "bp2_params": [ 0.195, -0.272, 1.159, 10.827, -1.434, -8.207 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.956, "simple_Twist": 38.358, "simple_hRise": 2.309, "simple_hTwist": 40.257 }, { "index": 2, "nt1": "///D/88", "nt2": "///D/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.272, 1.159, 10.827, -1.434, -8.207 ], "step_params": [ 0.671, -2.238, 3.588, 2.993, -0.208, 34.238 ], "heli_params": [ -3.751, -0.618, 3.645, -0.352, -5.072, 34.365 ], "bp2_params": [ 0.127, -0.110, 0.179, 8.325, -8.778, 2.350 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 34.822, "simple_hRise": 3.645, "simple_hTwist": 34.947 }, { "index": 3, "nt1": "///D/89", "nt2": "///D/113", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.110, 0.179, 8.325, -8.778, 2.350 ], "step_params": [ 0.203, -1.579, 3.993, 8.434, 11.579, 37.618 ], "heli_params": [ -3.832, 0.821, 3.352, 17.212, -12.537, 40.161 ], "bp2_params": [ 0.488, 0.735, -1.278, -13.991, -11.822, 5.232 ], "groove_widths": [ 14.965, null, 17.346, null ], "simple_Rise": 3.993, "simple_Twist": 35.302, "simple_hRise": 3.295, "simple_hTwist": 38.011 }, { "index": 4, "nt1": "///D/90", "nt2": "///D/112", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.488, 0.735, -1.278, -13.991, -11.822, 5.232 ], "step_params": [ -0.800, -1.821, 3.086, -2.202, 2.278, 36.535 ], "heli_params": [ -3.186, 0.990, 3.012, 3.625, 3.504, 36.667 ], "bp2_params": [ 1.462, 0.506, -0.659, -7.076, 3.836, -1.303 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.086, "simple_Twist": 32.395, "simple_hRise": 3.001, "simple_hTwist": 32.546 }, { "index": 5, "nt1": "///D/91", "nt2": "///D/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.462, 0.506, -0.659, -7.076, 3.836, -1.303 ], "step_params": [ -0.371, -2.556, 3.405, -13.451, 9.726, 17.363 ], "heli_params": [ -8.991, -3.031, 1.651, 25.795, 35.672, 23.977 ], "bp2_params": [ -0.966, 0.719, 1.165, -2.343, 18.860, 7.567 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.405, "simple_Twist": 29.025, "simple_hRise": 2.390, "simple_hTwist": 33.348 }, { "index": 6, "nt1": "///D/92", "nt2": "///D/110", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 1, "strand1": "TTTCATTTTCTGC", "strand2": "AAAGTAAAAGACG", "bp_type": "|||||||||||||", "helix_form": ".BBBB.BB.BBB", "helical_rise": 3.485, "helical_rise_std": 0.395, "helical_radius": 9.407, "helical_radius_std": 1.180, "helical_axis": [ -0.025, 0.914, 0.405 ], "point1": [ 124.323, 83.990, 100.661 ], "point2": [ 123.281, 122.284, 117.628 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///E/11", "nt2": "///G/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.052, -0.567, -1.459, -0.088, -11.810, 5.449 ], "step_params": [ -0.274, 1.107, 3.477, -2.517, 2.541, 45.207 ], "heli_params": [ 1.195, 0.116, 3.541, 3.299, 3.268, 45.340 ], "bp2_params": [ -0.272, 0.342, -0.709, 6.660, -15.925, 5.148 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.477, "simple_Twist": 46.993, "simple_hRise": 3.538, "simple_hTwist": 47.121 }, { "index": 2, "nt1": "///E/12", "nt2": "///G/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.272, 0.342, -0.709, 6.660, -15.925, 5.148 ], "step_params": [ 0.280, -0.411, 3.416, -2.657, 3.529, 31.043 ], "heli_params": [ -1.447, -1.035, 3.316, 6.551, 4.933, 31.348 ], "bp2_params": [ -0.109, -0.105, -0.242, 5.369, -12.470, 3.537 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.416, "simple_Twist": 30.073, "simple_hRise": 3.311, "simple_hTwist": 30.388 }, { "index": 3, "nt1": "///E/13", "nt2": "///G/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.105, -0.242, 5.369, -12.470, 3.537 ], "step_params": [ -0.009, 0.718, 3.501, -3.231, -1.740, 40.493 ], "heli_params": [ 1.240, -0.369, 3.459, -2.507, 4.657, 40.652 ], "bp2_params": [ 0.110, -0.169, 0.162, 4.688, -13.205, 2.389 ], "groove_widths": [ 10.055, null, 18.611, null ], "simple_Rise": 3.501, "simple_Twist": 39.161, "simple_hRise": 3.457, "simple_hTwist": 39.326 }, { "index": 4, "nt1": "///E/14", "nt2": "///G/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.169, 0.162, 4.688, -13.205, 2.389 ], "step_params": [ 0.412, -0.384, 3.326, -3.511, 2.529, 36.097 ], "heli_params": [ -0.970, -1.153, 3.239, 4.063, 5.641, 36.347 ], "bp2_params": [ -0.226, 0.292, 0.818, 3.496, -21.250, 13.923 ], "groove_widths": [ 10.181, 10.167, 19.048, 18.965 ], "simple_Rise": 3.326, "simple_Twist": 38.093, "simple_hRise": 3.245, "simple_hTwist": 38.329 }, { "index": 5, "nt1": "///E/15", "nt2": "///G/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, 0.292, 0.818, 3.496, -21.250, 13.923 ], "step_params": [ -0.817, -0.430, 3.522, 1.355, -2.021, 33.841 ], "heli_params": [ -0.388, 1.634, 3.506, -3.466, -2.325, 33.926 ], "bp2_params": [ -0.058, 0.642, 0.289, -3.396, -24.850, -0.144 ], "groove_widths": [ 9.418, 9.389, 18.632, 18.478 ], "simple_Rise": 3.522, "simple_Twist": 32.622, "simple_hRise": 3.505, "simple_hTwist": 32.711 }, { "index": 6, "nt1": "///E/16", "nt2": "///G/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, 0.642, 0.289, -3.396, -24.850, -0.144 ], "step_params": [ -0.350, -0.579, 3.243, 5.356, -0.102, 36.045 ], "heli_params": [ -0.912, 1.292, 3.161, -0.163, -8.597, 36.428 ], "bp2_params": [ 0.045, 0.776, -0.262, -3.949, -22.824, 5.080 ], "groove_widths": [ 9.250, 9.226, 17.979, 17.594 ], "simple_Rise": 3.243, "simple_Twist": 35.568, "simple_hRise": 3.160, "simple_hTwist": 35.957 }, { "index": 7, "nt1": "///E/17", "nt2": "///G/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, 0.776, -0.262, -3.949, -22.824, 5.080 ], "step_params": [ -0.418, -0.003, 3.261, 0.231, 5.651, 34.959 ], "heli_params": [ -0.834, 0.721, 3.219, 9.330, -0.381, 35.399 ], "bp2_params": [ 0.039, -0.098, -0.419, -3.727, -20.765, 4.748 ], "groove_widths": [ 9.210, 9.199, 17.285, 17.211 ], "simple_Rise": 3.261, "simple_Twist": 34.925, "simple_hRise": 3.219, "simple_hTwist": 35.366 }, { "index": 8, "nt1": "///E/18", "nt2": "///G/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.039, -0.098, -0.419, -3.727, -20.765, 4.748 ], "step_params": [ -0.138, 0.397, 3.529, 1.739, -0.042, 42.019 ], "heli_params": [ 0.558, 0.387, 3.521, -0.059, -2.425, 42.054 ], "bp2_params": [ -0.012, -0.165, -0.502, -7.273, -17.294, 0.166 ], "groove_widths": [ 9.888, 9.882, 19.875, 19.766 ], "simple_Rise": 3.529, "simple_Twist": 42.271, "simple_hRise": 3.521, "simple_hTwist": 42.305 }, { "index": 9, "nt1": "///E/19", "nt2": "///G/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.012, -0.165, -0.502, -7.273, -17.294, 0.166 ], "step_params": [ 0.464, 1.863, 3.576, -2.831, -2.392, 38.069 ], "heli_params": [ 3.166, -1.090, 3.415, -3.657, 4.327, 38.242 ], "bp2_params": [ 0.178, -0.140, -0.472, -9.118, -1.987, -1.581 ], "groove_widths": [ 11.778, 11.773, 18.732, 18.648 ], "simple_Rise": 3.576, "simple_Twist": 37.297, "simple_hRise": 3.411, "simple_hTwist": 37.474 }, { "index": 10, "nt1": "///E/20", "nt2": "///G/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.140, -0.472, -9.118, -1.987, -1.581 ], "step_params": [ -0.767, 0.478, 3.445, -5.152, 4.788, 28.566 ], "heli_params": [ -0.174, 0.311, 3.557, 9.522, 10.246, 29.402 ], "bp2_params": [ 0.230, 0.447, 0.029, -3.017, -7.575, 2.207 ], "groove_widths": [ 14.107, null, 18.569, null ], "simple_Rise": 3.445, "simple_Twist": 28.434, "simple_hRise": 3.557, "simple_hTwist": 29.273 }, { "index": 11, "nt1": "///E/21", "nt2": "///G/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.230, 0.447, 0.029, -3.017, -7.575, 2.207 ], "step_params": [ 0.806, 0.805, 3.305, 4.107, 8.630, 36.224 ], "heli_params": [ 0.060, -0.687, 3.468, 13.591, -6.468, 37.423 ], "bp2_params": [ -0.203, -0.081, -0.119, -1.698, -4.271, 3.497 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.305, "simple_Twist": 38.437, "simple_hRise": 3.464, "simple_hTwist": 39.564 }, { "index": 12, "nt1": "///E/22", "nt2": "///G/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.203, -0.081, -0.119, -1.698, -4.271, 3.497 ], "step_params": [ -0.668, 0.892, 3.558, -0.002, 2.087, 32.871 ], "heli_params": [ 1.184, 1.178, 3.606, 3.683, 0.003, 32.935 ], "bp2_params": [ 0.153, -0.180, -0.083, 2.725, -2.346, 2.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.558, "simple_Twist": 30.603, "simple_hRise": 3.609, "simple_hTwist": 30.672 }, { "index": 13, "nt1": "///E/23", "nt2": "///G/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 6, "stems": [ { "index": 1, "helix_index": 1, "strand1": "UUGCGUUGAUAAAAGUAUU", "strand2": "AACGCAACTATTTTCATAA", "bp_type": "|||||||||||||||||||", "helix_form": "AAA..A.AAAA..A....", "helical_rise": 2.918, "helical_rise_std": 0.657, "helical_radius": 10.233, "helical_radius_std": 2.005, "helical_axis": [ -0.076, -0.885, 0.459 ], "point1": [ 126.824, 174.385, 117.503 ], "point2": [ 122.854, 128.001, 141.581 ], "num_pairs": 19, "pairs": [ { "index": 1, "nt1": "///D/2", "nt2": "///E/42", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.103, -0.280, 0.781, 4.110, 16.236, -0.753 ], "step_params": [ 0.115, -2.189, 4.164, 6.457, 21.994, 33.000 ], "heli_params": [ -5.963, 0.643, 2.306, 34.083, -10.006, 39.997 ], "bp2_params": [ -0.037, 0.025, -0.025, -5.232, -0.090, -4.465 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.164, "simple_Twist": 33.046, "simple_hRise": 2.308, "simple_hTwist": 40.034 }, { "index": 2, "nt1": "///D/3", "nt2": "///E/41", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.037, 0.025, -0.025, -5.232, -0.090, -4.465 ], "step_params": [ -0.070, -1.769, 3.328, -3.638, 14.182, 23.516 ], "heli_params": [ -6.718, -0.627, 1.953, 31.219, 8.007, 27.647 ], "bp2_params": [ -0.161, -0.175, 0.366, -2.090, 5.567, -0.711 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.328, "simple_Twist": 23.994, "simple_hRise": 1.982, "simple_hTwist": 28.053 }, { "index": 3, "nt1": "///D/4", "nt2": "///E/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.161, -0.175, 0.366, -2.090, 5.567, -0.711 ], "step_params": [ 0.346, -1.589, 3.344, 1.572, 8.629, 37.705 ], "heli_params": [ -3.431, -0.335, 2.935, 13.134, -2.393, 38.676 ], "bp2_params": [ 0.157, -0.108, 0.312, 2.673, 2.317, -1.352 ], "groove_widths": [ 19.050, null, 19.512, null ], "simple_Rise": 3.344, "simple_Twist": 36.224, "simple_hRise": 2.915, "simple_hTwist": 37.236 }, { "index": 4, "nt1": "///D/5", "nt2": "///E/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.108, 0.312, 2.673, 2.317, -1.352 ], "step_params": [ -0.166, -1.779, 3.294, -0.340, 20.552, 25.855 ], "heli_params": [ -6.046, 0.245, 1.510, 39.019, 0.646, 32.920 ], "bp2_params": [ -0.264, -0.045, 0.063, -6.119, -6.128, 4.192 ], "groove_widths": [ 18.561, 16.386, 16.720, 11.265 ], "simple_Rise": 3.294, "simple_Twist": 27.438, "simple_hRise": 1.611, "simple_hTwist": 34.164 }, { "index": 5, "nt1": "///D/6", "nt2": "///E/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.045, 0.063, -6.119, -6.128, 4.192 ], "step_params": [ -0.737, -1.408, 3.410, 0.775, 5.647, 33.906 ], "heli_params": [ -3.271, 1.369, 3.125, 9.599, -1.317, 34.368 ], "bp2_params": [ -0.130, -0.017, -0.123, -5.349, 2.300, -7.956 ], "groove_widths": [ 17.730, 15.607, 16.464, 11.929 ], "simple_Rise": 3.410, "simple_Twist": 33.085, "simple_hRise": 3.117, "simple_hTwist": 33.559 }, { "index": 6, "nt1": "///D/7", "nt2": "///E/37", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.017, -0.123, -5.349, 2.300, -7.956 ], "step_params": [ 0.217, -1.490, 3.194, 2.670, 13.844, 30.168 ], "heli_params": [ -4.659, 0.017, 2.317, 24.957, -4.813, 33.230 ], "bp2_params": [ 0.023, -0.116, -0.021, 10.768, 5.313, -2.298 ], "groove_widths": [ 16.830, 14.903, 16.581, 12.810 ], "simple_Rise": 3.194, "simple_Twist": 29.756, "simple_hRise": 2.303, "simple_hTwist": 32.859 }, { "index": 7, "nt1": "///D/8", "nt2": "///E/36", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.023, -0.116, -0.021, 10.768, 5.313, -2.298 ], "step_params": [ -0.389, -1.427, 3.611, -3.507, 9.084, 31.966 ], "heli_params": [ -4.071, 0.064, 3.124, 16.036, 6.191, 33.380 ], "bp2_params": [ -0.198, -0.176, 0.225, -5.035, -14.694, -2.680 ], "groove_widths": [ 16.846, 15.638, 17.397, 15.550 ], "simple_Rise": 3.611, "simple_Twist": 32.834, "simple_hRise": 3.140, "simple_hTwist": 34.210 }, { "index": 8, "nt1": "///D/9", "nt2": "///E/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.176, 0.225, -5.035, -14.694, -2.680 ], "step_params": [ -0.256, -1.029, 3.453, -0.742, -0.648, 36.158 ], "heli_params": [ -1.560, 0.302, 3.475, -1.043, 1.196, 36.171 ], "bp2_params": [ 0.617, 0.515, 0.157, -5.564, -14.829, 2.392 ], "groove_widths": [ 16.985, 16.162, 18.409, 17.050 ], "simple_Rise": 3.453, "simple_Twist": 32.220, "simple_hRise": 3.478, "simple_hTwist": 32.235 }, { "index": 9, "nt1": "///D/10", "nt2": "///E/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.617, 0.515, 0.157, -5.564, -14.829, 2.392 ], "step_params": [ 0.405, -1.822, 3.363, -0.123, 1.443, 23.806 ], "heli_params": [ -4.888, -1.021, 3.246, 3.495, 0.297, 23.849 ], "bp2_params": [ -0.036, -0.020, 0.182, 0.033, -11.256, 2.185 ], "groove_widths": [ 16.788, 15.825, 19.682, 19.085 ], "simple_Rise": 3.363, "simple_Twist": 27.338, "simple_hRise": 3.262, "simple_hTwist": 27.376 }, { "index": 10, "nt1": "///D/11", "nt2": "///E/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.036, -0.020, 0.182, 0.033, -11.256, 2.185 ], "step_params": [ -0.346, -1.464, 3.400, -0.975, 8.002, 31.638 ], "heli_params": [ -3.980, 0.448, 2.960, 14.387, 1.752, 32.623 ], "bp2_params": [ 0.136, -0.083, 0.118, -3.141, -10.007, -0.589 ], "groove_widths": [ 17.047, 15.968, 17.861, 17.554 ], "simple_Rise": 3.400, "simple_Twist": 30.449, "simple_hRise": 2.939, "simple_hTwist": 31.474 }, { "index": 11, "nt1": "///D/12", "nt2": "///E/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, -0.083, 0.118, -3.141, -10.007, -0.589 ], "step_params": [ -0.298, -1.098, 3.467, -0.026, 3.703, 33.604 ], "heli_params": [ -2.512, 0.508, 3.331, 6.381, 0.044, 33.802 ], "bp2_params": [ -0.000, -0.026, -0.108, -2.123, -5.847, -0.664 ], "groove_widths": [ 17.560, 16.402, 18.889, 18.554 ], "simple_Rise": 3.467, "simple_Twist": 34.325, "simple_hRise": 3.334, "simple_hTwist": 34.518 }, { "index": 12, "nt1": "///D/13", "nt2": "///E/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.000, -0.026, -0.108, -2.123, -5.847, -0.664 ], "step_params": [ 0.986, -1.626, 3.634, 0.904, 3.371, 23.069 ], "heli_params": [ -5.269, -2.105, 3.400, 8.368, -2.245, 23.328 ], "bp2_params": [ -0.667, 0.716, -0.250, -1.248, -2.044, 11.154 ], "groove_widths": [ 17.625, 16.336, 19.469, 19.043 ], "simple_Rise": 3.634, "simple_Twist": 26.995, "simple_hRise": 3.440, "simple_hTwist": 27.216 }, { "index": 13, "nt1": "///D/14", "nt2": "///E/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.667, 0.716, -0.250, -1.248, -2.044, 11.154 ], "step_params": [ -0.618, -2.054, 3.563, -2.356, 6.516, 28.248 ], "heli_params": [ -5.562, 0.699, 3.062, 13.103, 4.737, 29.069 ], "bp2_params": [ 0.133, 0.024, -0.133, -0.665, -5.077, 0.519 ], "groove_widths": [ 17.505, 16.073, 22.008, 21.432 ], "simple_Rise": 3.563, "simple_Twist": 23.755, "simple_hRise": 2.949, "simple_hTwist": 24.731 }, { "index": 14, "nt1": "///D/15", "nt2": "///E/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, 0.024, -0.133, -0.665, -5.077, 0.519 ], "step_params": [ -0.152, -2.250, 3.738, 1.989, 7.452, 29.030 ], "heli_params": [ -5.966, 0.725, 3.061, 14.545, -3.882, 30.016 ], "bp2_params": [ -0.217, -0.065, -0.430, -4.498, -5.249, -0.369 ], "groove_widths": [ 17.475, 15.964, 22.346, 21.892 ], "simple_Rise": 3.738, "simple_Twist": 30.540, "simple_hRise": 3.100, "simple_hTwist": 31.476 }, { "index": 15, "nt1": "///D/16", "nt2": "///E/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.217, -0.065, -0.430, -4.498, -5.249, -0.369 ], "step_params": [ 0.947, -2.551, 3.393, -1.012, 3.520, 18.918 ], "heli_params": [ -9.317, -3.319, 2.822, 10.581, 3.043, 19.266 ], "bp2_params": [ -0.251, 0.520, -0.056, 3.896, -7.523, 9.140 ], "groove_widths": [ 17.124, 15.519, 21.101, 21.078 ], "simple_Rise": 3.393, "simple_Twist": 19.478, "simple_hRise": 2.839, "simple_hTwist": 19.816 }, { "index": 16, "nt1": "///D/17", "nt2": "///E/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.251, 0.520, -0.056, 3.896, -7.523, 9.140 ], "step_params": [ 0.881, -1.491, 3.536, 3.921, 8.571, 30.358 ], "heli_params": [ -4.357, -0.864, 3.098, 15.892, -7.271, 31.755 ], "bp2_params": [ -1.275, 0.399, 0.060, -6.756, -20.780, 19.466 ], "groove_widths": [ 16.736, null, 23.221, null ], "simple_Rise": 3.536, "simple_Twist": 35.687, "simple_hRise": 3.182, "simple_hTwist": 36.872 }, { "index": 17, "nt1": "///D/18", "nt2": "///E/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.275, 0.399, 0.060, -6.756, -20.780, 19.466 ], "step_params": [ -0.180, -0.777, 3.483, 1.501, 1.169, 34.408 ], "heli_params": [ -1.504, 0.551, 3.445, 1.975, -2.534, 34.459 ], "bp2_params": [ -0.283, 0.714, -0.100, -0.892, -15.459, 10.257 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.483, "simple_Twist": 29.508, "simple_hRise": 3.437, "simple_hTwist": 29.568 }, { "index": 18, "nt1": "///D/19", "nt2": "///E/25", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.283, 0.714, -0.100, -0.892, -15.459, 10.257 ], "step_params": [ 0.693, -2.308, 3.644, -1.405, -8.034, 22.440 ], "heli_params": [ -2.350, -2.241, 4.157, -19.823, 3.467, 23.859 ], "bp2_params": [ 0.618, 0.714, -0.313, 7.635, 4.287, 10.166 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.644, "simple_Twist": 17.453, "simple_hRise": 4.212, "simple_hTwist": 19.251 }, { "index": 19, "nt1": "///D/20", "nt2": "///E/24", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GUUUUUGUA", "strand2": "UAGAAACAU", "bp_type": "|||||||||", "helix_form": "...AAAAA", "helical_rise": 2.788, "helical_rise_std": 0.214, "helical_radius": 9.272, "helical_radius_std": 0.558, "helical_axis": [ -0.560, -0.821, 0.112 ], "point1": [ 120.641, 121.840, 143.634 ], "point2": [ 108.166, 103.536, 146.126 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///D/21", "nt2": "///D/67", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.336, -0.474, 0.373, 3.501, -6.074, -7.179 ], "step_params": [ -0.537, -1.545, 3.665, -4.207, 8.104, 38.893 ], "heli_params": [ -3.277, 0.262, 3.329, 11.971, 6.214, 39.910 ], "bp2_params": [ -0.151, 0.018, -0.016, 1.773, -3.988, -2.110 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.665, "simple_Twist": 27.440, "simple_hRise": 3.137, "simple_hTwist": 28.892 }, { "index": 2, "nt1": "///D/22", "nt2": "///D/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, 0.018, -0.016, 1.773, -3.988, -2.110 ], "step_params": [ 0.084, -1.486, 3.419, -0.898, 9.641, 38.978 ], "heli_params": [ -3.259, -0.224, 2.981, 14.184, 1.321, 40.117 ], "bp2_params": [ 2.051, -0.267, 0.155, 2.165, -5.900, 0.357 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.419, "simple_Twist": 27.137, "simple_hRise": 2.737, "simple_hTwist": 28.782 }, { "index": 3, "nt1": "///D/23", "nt2": "///D/65", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.051, -0.267, 0.155, 2.165, -5.900, 0.357 ], "step_params": [ -0.629, -2.215, 3.170, -1.658, 10.558, 25.043 ], "heli_params": [ -6.944, 0.986, 2.115, 23.055, 3.621, 27.195 ], "bp2_params": [ -0.134, -0.056, 0.441, -1.141, -11.716, -2.511 ], "groove_widths": [ 17.554, null, 15.336, null ], "simple_Rise": 3.170, "simple_Twist": 36.820, "simple_hRise": 2.490, "simple_hTwist": 38.289 }, { "index": 4, "nt1": "///D/24", "nt2": "///D/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.134, -0.056, 0.441, -1.141, -11.716, -2.511 ], "step_params": [ -0.262, -1.328, 3.286, 0.827, 7.634, 33.510 ], "heli_params": [ -3.395, 0.568, 2.915, 13.029, -1.411, 34.354 ], "bp2_params": [ -0.067, 0.009, 0.165, -1.724, -12.375, -4.961 ], "groove_widths": [ 17.426, 15.911, 15.555, 12.138 ], "simple_Rise": 3.286, "simple_Twist": 33.569, "simple_hRise": 2.916, "simple_hTwist": 34.412 }, { "index": 5, "nt1": "///D/25", "nt2": "///D/63", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.067, 0.009, 0.165, -1.724, -12.375, -4.961 ], "step_params": [ 0.527, -1.540, 3.264, 1.660, 4.305, 32.819 ], "heli_params": [ -3.404, -0.653, 3.065, 7.572, -2.920, 33.133 ], "bp2_params": [ 0.040, 0.030, 0.006, 0.507, -10.242, -1.562 ], "groove_widths": [ 17.455, 16.034, 15.588, 12.682 ], "simple_Rise": 3.264, "simple_Twist": 32.189, "simple_hRise": 3.061, "simple_hTwist": 32.509 }, { "index": 6, "nt1": "///D/26", "nt2": "///D/62", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, 0.030, 0.006, 0.507, -10.242, -1.562 ], "step_params": [ 0.109, -1.609, 3.358, -0.901, 13.356, 31.038 ], "heli_params": [ -4.791, -0.325, 2.472, 23.629, 1.595, 33.736 ], "bp2_params": [ -0.185, -0.126, 0.215, -3.230, -9.820, -1.788 ], "groove_widths": [ 17.713, null, 16.903, null ], "simple_Rise": 3.358, "simple_Twist": 31.935, "simple_hRise": 2.502, "simple_hTwist": 34.559 }, { "index": 7, "nt1": "///D/27", "nt2": "///D/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.126, 0.215, -3.230, -9.820, -1.788 ], "step_params": [ -0.281, -1.480, 3.420, -1.637, 5.834, 32.212 ], "heli_params": [ -3.637, 0.214, 3.121, 10.401, 2.917, 32.762 ], "bp2_params": [ -0.206, -0.037, 0.332, -0.911, -8.690, -5.349 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.420, "simple_Twist": 32.685, "simple_hRise": 3.126, "simple_hTwist": 33.227 }, { "index": 8, "nt1": "///D/28", "nt2": "///D/60", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.037, 0.332, -0.911, -8.690, -5.349 ], "step_params": [ 0.649, -1.985, 3.352, -1.064, 12.205, 29.071 ], "heli_params": [ -5.718, -1.376, 2.325, 23.064, 2.012, 31.495 ], "bp2_params": [ -0.021, -0.107, 0.512, -6.285, -8.164, 0.440 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.352, "simple_Twist": 27.538, "simple_hRise": 2.261, "simple_hTwist": 30.092 }, { "index": 9, "nt1": "///D/29", "nt2": "///D/59", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "UCU", "strand2": "AGA", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.159, "helical_rise_std": 0.095, "helical_radius": 9.160, "helical_radius_std": 0.588, "helical_axis": [ -0.701, -0.634, 0.327 ], "point1": [ 104.429, 97.682, 149.557 ], "point2": [ 100.001, 93.682, 151.618 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///D/31", "nt2": "///D/55", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.173, 0.888, 3.987, -7.629, -8.482 ], "step_params": [ -0.113, -1.903, 3.262, -1.374, 1.657, 35.773 ], "heli_params": [ -3.327, -0.010, 3.175, 2.694, 2.234, 35.836 ], "bp2_params": [ 0.150, -0.247, 0.702, 2.855, -5.088, -3.266 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.262, "simple_Twist": 34.143, "simple_hRise": 3.171, "simple_hTwist": 34.209 }, { "index": 2, "nt1": "///D/32", "nt2": "///D/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.247, 0.702, 2.855, -5.088, -3.266 ], "step_params": [ 0.498, -1.785, 3.367, 0.425, 3.381, 31.765 ], "heli_params": [ -3.858, -0.827, 3.171, 6.155, -0.774, 31.943 ], "bp2_params": [ -0.038, -0.179, 0.306, 4.359, -4.082, 2.794 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.367, "simple_Twist": 32.328, "simple_hRise": 3.175, "simple_hTwist": 32.503 }, { "index": 3, "nt1": "///D/33", "nt2": "///D/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "GGC", "strand2": "CCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.493, "helical_rise_std": 0.037, "helical_radius": 11.066, "helical_radius_std": 0.534, "helical_axis": [ 0.522, -0.327, 0.788 ], "point1": [ 132.499, 124.064, 142.802 ], "point2": [ 136.168, 121.763, 148.341 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///D/70", "nt2": "///D/80", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.079, -0.058, -6.028, -1.135, -0.972 ], "step_params": [ 0.683, -2.319, 3.404, 2.555, 3.349, 25.794 ], "heli_params": [ -6.046, -0.810, 3.135, 7.438, -5.674, 26.130 ], "bp2_params": [ -0.202, 0.004, -0.060, -2.485, -2.085, 2.093 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.404, "simple_Twist": 26.153, "simple_hRise": 3.139, "simple_hTwist": 26.485 }, { "index": 2, "nt1": "///D/71", "nt2": "///D/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.202, 0.004, -0.060, -2.485, -2.085, 2.093 ], "step_params": [ -0.212, -2.484, 3.527, 3.350, 2.374, 28.410 ], "heli_params": [ -5.569, 1.215, 3.267, 4.805, -6.781, 28.699 ], "bp2_params": [ -0.329, 0.423, -0.377, 1.488, -1.466, -1.570 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.527, "simple_Twist": 28.931, "simple_hRise": 3.272, "simple_hTwist": 29.215 }, { "index": 3, "nt1": "///D/72", "nt2": "///D/78", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "ACACC", "strand2": "UGUGG", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.948, "helical_rise_std": 0.487, "helical_radius": 9.863, "helical_radius_std": 0.695, "helical_axis": [ 0.468, 0.051, 0.882 ], "point1": [ 156.926, 136.261, 107.603 ], "point2": [ 162.405, 136.861, 117.942 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///D/88", "nt2": "///D/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.272, 1.159, 10.827, -1.434, -8.207 ], "step_params": [ 0.671, -2.238, 3.588, 2.993, -0.208, 34.238 ], "heli_params": [ -3.751, -0.618, 3.645, -0.352, -5.072, 34.365 ], "bp2_params": [ 0.127, -0.110, 0.179, 8.325, -8.778, 2.350 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 34.822, "simple_hRise": 3.645, "simple_hTwist": 34.947 }, { "index": 2, "nt1": "///D/89", "nt2": "///D/113", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.110, 0.179, 8.325, -8.778, 2.350 ], "step_params": [ 0.203, -1.579, 3.993, 8.434, 11.579, 37.618 ], "heli_params": [ -3.832, 0.821, 3.352, 17.212, -12.537, 40.161 ], "bp2_params": [ 0.488, 0.735, -1.278, -13.991, -11.822, 5.232 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.993, "simple_Twist": 35.302, "simple_hRise": 3.295, "simple_hTwist": 38.011 }, { "index": 3, "nt1": "///D/90", "nt2": "///D/112", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.488, 0.735, -1.278, -13.991, -11.822, 5.232 ], "step_params": [ -0.800, -1.821, 3.086, -2.202, 2.278, 36.535 ], "heli_params": [ -3.186, 0.990, 3.012, 3.625, 3.504, 36.667 ], "bp2_params": [ 1.462, 0.506, -0.659, -7.076, 3.836, -1.303 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.086, "simple_Twist": 32.395, "simple_hRise": 3.001, "simple_hTwist": 32.546 }, { "index": 4, "nt1": "///D/91", "nt2": "///D/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.462, 0.506, -0.659, -7.076, 3.836, -1.303 ], "step_params": [ -0.371, -2.556, 3.405, -13.451, 9.726, 17.363 ], "heli_params": [ -8.991, -3.031, 1.651, 25.795, 35.672, 23.977 ], "bp2_params": [ -0.966, 0.719, 1.165, -2.343, 18.860, 7.567 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.405, "simple_Twist": 29.025, "simple_hRise": 2.390, "simple_hTwist": 33.348 }, { "index": 5, "nt1": "///D/92", "nt2": "///D/110", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 4, "strand1": "TTTCATTTTCTGC", "strand2": "AAAGTAAAAGACG", "bp_type": "|||||||||||||", "helix_form": ".BBBB.BB.BBB", "helical_rise": 3.485, "helical_rise_std": 0.395, "helical_radius": 9.407, "helical_radius_std": 1.180, "helical_axis": [ -0.025, 0.914, 0.405 ], "point1": [ 124.323, 83.990, 100.661 ], "point2": [ 123.281, 122.284, 117.628 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///E/11", "nt2": "///G/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.052, -0.567, -1.459, -0.088, -11.810, 5.449 ], "step_params": [ -0.274, 1.107, 3.477, -2.517, 2.541, 45.207 ], "heli_params": [ 1.195, 0.116, 3.541, 3.299, 3.268, 45.340 ], "bp2_params": [ -0.272, 0.342, -0.709, 6.660, -15.925, 5.148 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.477, "simple_Twist": 46.993, "simple_hRise": 3.538, "simple_hTwist": 47.121 }, { "index": 2, "nt1": "///E/12", "nt2": "///G/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.272, 0.342, -0.709, 6.660, -15.925, 5.148 ], "step_params": [ 0.280, -0.411, 3.416, -2.657, 3.529, 31.043 ], "heli_params": [ -1.447, -1.035, 3.316, 6.551, 4.933, 31.348 ], "bp2_params": [ -0.109, -0.105, -0.242, 5.369, -12.470, 3.537 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.416, "simple_Twist": 30.073, "simple_hRise": 3.311, "simple_hTwist": 30.388 }, { "index": 3, "nt1": "///E/13", "nt2": "///G/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.105, -0.242, 5.369, -12.470, 3.537 ], "step_params": [ -0.009, 0.718, 3.501, -3.231, -1.740, 40.493 ], "heli_params": [ 1.240, -0.369, 3.459, -2.507, 4.657, 40.652 ], "bp2_params": [ 0.110, -0.169, 0.162, 4.688, -13.205, 2.389 ], "groove_widths": [ 10.055, null, 18.611, null ], "simple_Rise": 3.501, "simple_Twist": 39.161, "simple_hRise": 3.457, "simple_hTwist": 39.326 }, { "index": 4, "nt1": "///E/14", "nt2": "///G/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.169, 0.162, 4.688, -13.205, 2.389 ], "step_params": [ 0.412, -0.384, 3.326, -3.511, 2.529, 36.097 ], "heli_params": [ -0.970, -1.153, 3.239, 4.063, 5.641, 36.347 ], "bp2_params": [ -0.226, 0.292, 0.818, 3.496, -21.250, 13.923 ], "groove_widths": [ 10.181, 10.167, 19.048, 18.965 ], "simple_Rise": 3.326, "simple_Twist": 38.093, "simple_hRise": 3.245, "simple_hTwist": 38.329 }, { "index": 5, "nt1": "///E/15", "nt2": "///G/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, 0.292, 0.818, 3.496, -21.250, 13.923 ], "step_params": [ -0.817, -0.430, 3.522, 1.355, -2.021, 33.841 ], "heli_params": [ -0.388, 1.634, 3.506, -3.466, -2.325, 33.926 ], "bp2_params": [ -0.058, 0.642, 0.289, -3.396, -24.850, -0.144 ], "groove_widths": [ 9.418, 9.389, 18.632, 18.478 ], "simple_Rise": 3.522, "simple_Twist": 32.622, "simple_hRise": 3.505, "simple_hTwist": 32.711 }, { "index": 6, "nt1": "///E/16", "nt2": "///G/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, 0.642, 0.289, -3.396, -24.850, -0.144 ], "step_params": [ -0.350, -0.579, 3.243, 5.356, -0.102, 36.045 ], "heli_params": [ -0.912, 1.292, 3.161, -0.163, -8.597, 36.428 ], "bp2_params": [ 0.045, 0.776, -0.262, -3.949, -22.824, 5.080 ], "groove_widths": [ 9.250, 9.226, 17.979, 17.594 ], "simple_Rise": 3.243, "simple_Twist": 35.568, "simple_hRise": 3.160, "simple_hTwist": 35.957 }, { "index": 7, "nt1": "///E/17", "nt2": "///G/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, 0.776, -0.262, -3.949, -22.824, 5.080 ], "step_params": [ -0.418, -0.003, 3.261, 0.231, 5.651, 34.959 ], "heli_params": [ -0.834, 0.721, 3.219, 9.330, -0.381, 35.399 ], "bp2_params": [ 0.039, -0.098, -0.419, -3.727, -20.765, 4.748 ], "groove_widths": [ 9.210, 9.199, 17.285, 17.211 ], "simple_Rise": 3.261, "simple_Twist": 34.925, "simple_hRise": 3.219, "simple_hTwist": 35.366 }, { "index": 8, "nt1": "///E/18", "nt2": "///G/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.039, -0.098, -0.419, -3.727, -20.765, 4.748 ], "step_params": [ -0.138, 0.397, 3.529, 1.739, -0.042, 42.019 ], "heli_params": [ 0.558, 0.387, 3.521, -0.059, -2.425, 42.054 ], "bp2_params": [ -0.012, -0.165, -0.502, -7.273, -17.294, 0.166 ], "groove_widths": [ 9.888, 9.882, 19.875, 19.766 ], "simple_Rise": 3.529, "simple_Twist": 42.271, "simple_hRise": 3.521, "simple_hTwist": 42.305 }, { "index": 9, "nt1": "///E/19", "nt2": "///G/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.012, -0.165, -0.502, -7.273, -17.294, 0.166 ], "step_params": [ 0.464, 1.863, 3.576, -2.831, -2.392, 38.069 ], "heli_params": [ 3.166, -1.090, 3.415, -3.657, 4.327, 38.242 ], "bp2_params": [ 0.178, -0.140, -0.472, -9.118, -1.987, -1.581 ], "groove_widths": [ 11.778, 11.773, 18.732, 18.648 ], "simple_Rise": 3.576, "simple_Twist": 37.297, "simple_hRise": 3.411, "simple_hTwist": 37.474 }, { "index": 10, "nt1": "///E/20", "nt2": "///G/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.178, -0.140, -0.472, -9.118, -1.987, -1.581 ], "step_params": [ -0.767, 0.478, 3.445, -5.152, 4.788, 28.566 ], "heli_params": [ -0.174, 0.311, 3.557, 9.522, 10.246, 29.402 ], "bp2_params": [ 0.230, 0.447, 0.029, -3.017, -7.575, 2.207 ], "groove_widths": [ 14.107, null, 18.569, null ], "simple_Rise": 3.445, "simple_Twist": 28.434, "simple_hRise": 3.557, "simple_hTwist": 29.273 }, { "index": 11, "nt1": "///E/21", "nt2": "///G/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.230, 0.447, 0.029, -3.017, -7.575, 2.207 ], "step_params": [ 0.806, 0.805, 3.305, 4.107, 8.630, 36.224 ], "heli_params": [ 0.060, -0.687, 3.468, 13.591, -6.468, 37.423 ], "bp2_params": [ -0.203, -0.081, -0.119, -1.698, -4.271, 3.497 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.305, "simple_Twist": 38.437, "simple_hRise": 3.464, "simple_hTwist": 39.564 }, { "index": 12, "nt1": "///E/22", "nt2": "///G/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.203, -0.081, -0.119, -1.698, -4.271, 3.497 ], "step_params": [ -0.668, 0.892, 3.558, -0.002, 2.087, 32.871 ], "heli_params": [ 1.184, 1.178, 3.606, 3.683, 0.003, 32.935 ], "bp2_params": [ 0.153, -0.180, -0.083, 2.725, -2.346, 2.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.558, "simple_Twist": 30.603, "simple_hRise": 3.609, "simple_hTwist": 30.672 }, { "index": 13, "nt1": "///E/23", "nt2": "///G/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 2, "nt1": "///D/73", "nt2": "///D/76", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 12, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "RU", "nts_long": "///C/223,///D/77" }, { "index": 2, "num_nts": 2, "nts_short": "HU", "nts_long": "///C/1108,///D/115" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///D/21,///E/24" }, { "index": 4, "num_nts": 2, "nts_short": "AC", "nts_long": "///D/29,///D/30" }, { "index": 5, "num_nts": 2, "nts_short": "CU", "nts_long": "///D/58,///D/59" }, { "index": 6, "num_nts": 2, "nts_short": "CU", "nts_long": "///D/72,///D/73" }, { "index": 7, "num_nts": 2, "nts_short": "AA", "nts_long": "///D/87,///D/88" }, { "index": 8, "num_nts": 3, "nts_short": "RGG", "nts_long": "///C/53,///D/81,///D/70" }, { "index": 9, "num_nts": 3, "nts_short": "AAG", "nts_long": "///D/55,///D/56,///D/57" }, { "index": 10, "num_nts": 3, "nts_short": "CAG", "nts_long": "///D/75,///D/76,///D/78" }, { "index": 11, "num_nts": 4, "nts_short": "RAAU", "nts_long": "///C/46,///D/83,///D/84,///D/85" }, { "index": 12, "num_nts": 4, "nts_short": "NAAA", "nts_long": "///C/49,///D/82,///D/68,///D/69" } ], "nonStack": { "num_nts": 5, "nts_short": "UUUCC", "nts_long": "///D/2,///D/20,///D/31,///D/86,///D/92" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///D/75/O4'", "nt": "///D/76", "vert_dist": 3.237 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 2 ], "stem_indices": [ -1 ], "summary": "[1] 2 [D.73 D.76] 1", "num_nts": 4, "nts_short": "UUCA", "nts_long": "///D/73,///D/74,///D/75,///D/76", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UC", "nts_long": "///D/74,///D/75" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 4, -1 ], "summary": "[2] 0 1 [D.72 D.78 D.73 D.76] 3 1", "num_nts": 5, "nts_short": "CUAUG", "nts_long": "///D/72,///D/73,///D/76,///D/77,///D/78", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///D/77" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 1, 3 ], "stem_indices": [ 2, 3 ], "summary": "[2] 1 3 [D.29 D.59 D.31 D.55] 9 3", "num_nts": 8, "nts_short": "ACUAAGCU", "nts_long": "///D/29,///D/30,///D/31,///D/55,///D/56,///D/57,///D/58,///D/59", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///D/30" }, { "index": 2, "num_nts": 3, "nts_short": "AGC", "nts_long": "///D/56,///D/57,///D/58" } ] } ], "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///D/68,///D/69" }, { "index": 2, "num_nts": 7, "nts_short": "GAAAUCA", "nts_long": "///D/81,///D/82,///D/83,///D/84,///D/85,///D/86,///D/87" }, { "index": 3, "num_nts": 1, "nts_short": "U", "nts_long": "///D/115" } ], "num_splayUnits": 5, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///D/67,///D/68" }, { "index": 2, "num_nts": 3, "nts_short": "AUG", "nts_long": "///D/76,///D/77,///D/78" }, { "index": 3, "num_nts": 2, "nts_short": "AA", "nts_long": "///D/82,///D/83" }, { "index": 4, "num_nts": 2, "nts_short": "CA", "nts_long": "///D/86,///D/87" }, { "index": 5, "num_nts": 2, "nts_short": "CA", "nts_long": "///E/23,///E/24" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 26, "nts_short": "TTTCATTTTCTGCGCAGAAAATGAAA", "nts_long": "///E/11,///E/12,///E/13,///E/14,///E/15,///E/16,///E/17,///E/18,///E/19,///E/20,///E/21,///E/22,///E/23,///G/1,///G/2,///G/3,///G/4,///G/5,///G/6,///G/7,///G/8,///G/9,///G/10,///G/11,///G/12,///G/13" } ], "dbn": { "all_chains": { "num_nts": 123, "num_chars": 127, "bseq": "UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU&AGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACC&GGUGUU&TTTCATTTTCTGCAATACTTTTATCAACGCAA&GCAGAAAATGAAA", "sstr": "((((((((((((((((((((((((((((.(((&)))...)))))))))..((((..).))).......(((((&))))).&[[[[[[[[[[[[[)))))))))))))))))))&]]]]]]]]]]]]]", "form": "AAAAAA.AAAAA.A.AA..AAAAAAAA..AA-&AAA...AAAAAAAA...AAA......AA..A...AAAA.-&.A...-&..BBBBBBBBBB...A.AA.AAAAAA..AA.-&B.B.BBB.BBBB-" }, "chain_D": { "num_nts": 78, "num_chars": 80, "bseq": "UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU&AGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACC&GGUGUU", "sstr": "((((((((((((((((((((((((((((.(((&)))...)))))))))..((((..).))).......(((((&))))).", "form": "AAAAAA.AAAAA.A.AA..AAAAAAAA..AA-&AAA...AAAAAAAA...AAA......AA..A...AAAA.-&.A...-" }, "chain_E": { "num_nts": 32, "num_chars": 32, "bseq": "TTTCATTTTCTGCAATACTTTTATCAACGCAA", "sstr": "[[[[[[[[[[[[[)))))))))))))))))))", "form": "..BBBBBBBBBB...A.AA.AAAAAA..AA.-" }, "chain_G": { "num_nts": 13, "num_chars": 13, "bseq": "GCAGAAAATGAAA", "sstr": "]]]]]]]]]]]]]", "form": "B.B.BBB.BBBB-" } }, "chains": { "chain_D": { "num_nts": 78, "bseq": "UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU&AGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACC&GGUGUU", "sstr": "((((((((((((((((((((((((((((.(((&)))...)))))))))..((((..).))).......(((((&))))).", "form": "AAAAAA.AAAAA.A.AA..AAAAAAAA..AA-&AAA...AAAAAAAA...AAA......AA..A...AAAA.-&.A...-", "helical_rise": 0.380, "helical_rise_std": 3.190, "helical_axis": [ 0.196, -0.768, 0.609 ], "point1": [ 123.696, 157.578, 106.858 ], "point2": [ 129.432, 135.052, 124.724 ], "num_chars": 232, "suite": "U1aU1aG1aC1cG!!U1bU4nG1aA1aU1aA1aA1aA1aA1aG1cU1aA1aU1eU1aG1aU1aU1aU1aU1aU1aG1aU1aA1aC1aU1aC1cU..A1cG1aA1aA1bG6nC1aU1cA1aC1aA1cA1aA1aG1aA1aU!!A1aA1cG1aG1aC1bU!!U2[C!!A8dU!!G1aC1aC1aG1[A2aA1aA1aU1[C4dA1cA1aC!!A1aC1cC..G!!G1aU!!G1bU!!U" }, "chain_E": { "num_nts": 32, "bseq": "TTTCATTTTCTGCAATACTTTTATCAACGCAA", "sstr": "[[[[[[[[[[[[[)))))))))))))))))))", "form": "..BBBBBBBBBB...A.AA.AAAAAA..AA.-", "helical_rise": 2.972, "helical_rise_std": 1.052, "helical_axis": [ 0.043, 0.990, -0.138 ], "point1": [ 120.712, 87.031, 128.777 ], "point2": [ 124.670, 178.995, 115.969 ], "num_chars": 94, "suite": "T!!T!!T!!C!!A!!T!!T!!T!!T!!C4bT!!G4bC!!A!!A1aT!!A1eC1aT1aT1aT1aT1aA1aT1cC!!A!!A!!C1eG1cC!!A1aA" }, "chain_G": { "num_nts": 13, "bseq": "GCAGAAAATGAAA", "sstr": "]]]]]]]]]]]]]", "form": "B.B.BBB.BBBB-", "helical_rise": 3.391, "helical_rise_std": 0.390, "helical_axis": [ 0.003, -0.888, -0.460 ], "point1": [ 123.282, 121.125, 118.504 ], "point2": [ 123.410, 84.967, 99.792 ], "num_chars": 37, "suite": "G!!C4bA!!G!!A!!A!!A!!A!!T!!G!!A!!A!!A" } }, "num_nts": 123, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": 2, "nt_name": "U", "nt_code": "U", "nt_id": "///D/2", "linked_nts": [ null, "///D/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -125.326, "gamma": 158.429, "delta": 83.215, "epsilon": -142.502, "zeta": -67.421, "epsilon_zeta": -75.081, "bb_type": "BI", "chi": -169.248, "glyco_bond": "anti", "C5prime_xyz": [ -1.121, 8.541, 1.078 ], "P_xyz": [ 0.886, 8.871, -0.566 ], "form": "A", "ssZp": 4.608, "Dp": 4.676, "splay_angle": 26.758, "splay_distance": 4.327, "splay_ratio": 0.235, "d22": 4.711, "d64": 4.787, "eta": null, "theta": -135.014, "eta_prime": null, "theta_prime": -145.678, "eta_base": null, "theta_base": -132.928, "v0": 3.823, "v1": -25.110, "v2": 35.760, "v3": -34.449, "v4": 19.377, "amplitude": 36.663, "phase_angle": 12.745, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.112, "frame": { "rmsd": 0.013, "origin": [ 133.287, 173.765, 118.396 ], "x_axis": [ -0.921, -0.171, -0.351 ], "y_axis": [ 0.298, -0.889, -0.347 ], "z_axis": [ -0.253, -0.424, 0.870 ], "quaternion": [ -0.122, -0.157, -0.201, 0.959 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -88.103, "beta": -172.201, "gamma": 62.755, "delta": 77.326, "epsilon": -143.253, "zeta": -82.309, "epsilon_zeta": -60.943, "bb_type": "BI", "chi": -159.401, "glyco_bond": "anti", "C5prime_xyz": [ -1.648, 8.805, 0.440 ], "P_xyz": [ 0.852, 9.546, 0.504 ], "form": "A", "ssZp": 4.406, "Dp": 4.674, "splay_angle": 24.635, "splay_distance": 4.005, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 159.748, "theta": -154.217, "eta_prime": 173.030, "theta_prime": -153.012, "eta_base": -154.092, "theta_base": -133.802, "v0": 1.309, "v1": -25.882, "v2": 39.406, "v3": -39.500, "v4": 24.108, "amplitude": 41.144, "phase_angle": 16.713, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.495, "filter_rmsd": 0.101, "frame": { "rmsd": 0.013, "origin": [ 130.819, 173.560, 121.944 ], "x_axis": [ -0.553, -0.492, -0.672 ], "y_axis": [ 0.711, -0.700, -0.072 ], "z_axis": [ -0.435, -0.517, 0.737 ], "quaternion": [ -0.348, -0.320, -0.170, 0.865 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.707, "beta": 163.953, "gamma": 60.590, "delta": 75.205, "epsilon": -149.575, "zeta": -78.740, "epsilon_zeta": -70.835, "bb_type": "BI", "chi": -171.285, "glyco_bond": "anti", "C5prime_xyz": [ -1.682, 8.775, 1.069 ], "P_xyz": [ 0.810, 9.511, 1.076 ], "form": "A", "ssZp": 4.643, "Dp": 4.662, "splay_angle": 24.147, "splay_distance": 3.711, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 167.158, "theta": -155.131, "eta_prime": 176.896, "theta_prime": -151.886, "eta_base": -152.118, "theta_base": -119.815, "v0": -1.214, "v1": -23.525, "v2": 38.058, "v3": -39.540, "v4": 25.886, "amplitude": 40.555, "phase_angle": 20.208, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 127.596, 172.627, 124.130 ], "x_axis": [ -0.056, -0.573, -0.818 ], "y_axis": [ 0.875, -0.422, 0.236 ], "z_axis": [ -0.480, -0.703, 0.525 ], "quaternion": [ 0.512, 0.459, 0.165, -0.708 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -50.119, "beta": -179.115, "gamma": 38.609, "delta": 90.030, "epsilon": -165.481, "zeta": -87.218, "epsilon_zeta": -78.263, "bb_type": "BI", "chi": -154.862, "glyco_bond": "anti", "C5prime_xyz": [ -1.158, 8.628, 0.308 ], "P_xyz": [ 1.408, 8.880, 0.798 ], "form": "A", "ssZp": 4.317, "Dp": 4.468, "splay_angle": 22.351, "splay_distance": 3.650, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 173.748, "theta": -133.647, "eta_prime": -174.543, "theta_prime": -141.381, "eta_base": -132.111, "theta_base": -123.159, "v0": 11.403, "v1": -29.673, "v2": 35.856, "v3": -30.057, "v4": 11.926, "amplitude": 35.857, "phase_angle": 0.471, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.446, "filter_rmsd": 0.072, "frame": { "rmsd": 0.015, "origin": [ 124.810, 170.223, 124.610 ], "x_axis": [ 0.538, -0.634, -0.556 ], "y_axis": [ 0.690, -0.047, 0.722 ], "z_axis": [ -0.484, -0.772, 0.412 ], "quaternion": [ 0.690, 0.542, 0.026, -0.480 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": 6, "nt_name": "G", "nt_code": "G", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 159.547, "beta": -151.700, "gamma": 163.947, "delta": 88.927, "epsilon": -93.464, "zeta": -128.198, "epsilon_zeta": 34.734, "bb_type": "--", "chi": 177.360, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.257, 1.956 ], "P_xyz": [ 0.724, 9.477, 1.308 ], "form": "A", "ssZp": 4.388, "Dp": 4.527, "splay_angle": 22.129, "splay_distance": 3.690, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 172.936, "theta": -138.155, "eta_prime": -177.445, "theta_prime": -146.177, "eta_base": -144.464, "theta_base": -128.594, "v0": 11.773, "v1": -29.458, "v2": 35.045, "v3": -29.187, "v4": 11.064, "amplitude": 35.046, "phase_angle": 359.479, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.402, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 122.480, 167.417, 124.482 ], "x_axis": [ 0.909, -0.333, -0.250 ], "y_axis": [ 0.344, 0.261, 0.902 ], "z_axis": [ -0.235, -0.906, 0.352 ], "quaternion": [ 0.794, 0.569, 0.005, -0.213 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 98.234, "beta": -120.338, "gamma": -163.095, "delta": 89.062, "epsilon": -129.311, "zeta": -60.512, "epsilon_zeta": -68.799, "bb_type": "BI", "chi": -179.364, "glyco_bond": "anti", "C5prime_xyz": [ -1.278, 8.261, 1.859 ], "P_xyz": [ 0.466, 9.754, 0.608 ], "form": "A", "ssZp": 4.285, "Dp": 4.516, "splay_angle": 21.770, "splay_distance": 3.612, "splay_ratio": 0.194, "d22": 4.681, "d64": 4.327, "eta": 157.640, "theta": -143.924, "eta_prime": 175.561, "theta_prime": -135.886, "eta_base": -149.282, "theta_base": -117.665, "v0": 11.297, "v1": -28.966, "v2": 34.864, "v3": -29.240, "v4": 11.338, "amplitude": 34.864, "phase_angle": 0.168, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.019, "origin": [ 121.174, 163.993, 124.047 ], "x_axis": [ 0.985, -0.051, 0.162 ], "y_axis": [ -0.137, 0.332, 0.933 ], "z_axis": [ -0.101, -0.942, 0.320 ], "quaternion": [ 0.812, 0.578, -0.081, 0.026 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.122, "beta": -156.573, "gamma": 53.863, "delta": 149.305, "epsilon": -142.828, "zeta": -140.622, "epsilon_zeta": -2.206, "bb_type": "--", "chi": -105.141, "glyco_bond": "anti", "C5prime_xyz": [ -2.302, 8.323, -1.647 ], "P_xyz": [ -0.115, 9.674, -1.059 ], "form": ".", "ssZp": 2.001, "Dp": 1.891, "splay_angle": 22.521, "splay_distance": 4.050, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 167.101, "theta": -126.583, "eta_prime": -156.553, "theta_prime": -160.438, "eta_base": -128.375, "theta_base": -122.993, "v0": -19.455, "v1": 35.676, "v2": -37.008, "v3": 26.799, "v4": -4.798, "amplitude": 37.790, "phase_angle": 168.326, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.502, "filter_rmsd": 0.100, "frame": { "rmsd": 0.012, "origin": [ 122.169, 160.526, 123.858 ], "x_axis": [ 0.738, 0.357, 0.573 ], "y_axis": [ -0.638, 0.091, 0.765 ], "z_axis": [ 0.220, -0.930, 0.295 ], "quaternion": [ 0.729, 0.581, -0.121, 0.341 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 71.653, "beta": -141.172, "gamma": -147.857, "delta": 85.631, "epsilon": -143.398, "zeta": -75.475, "epsilon_zeta": -67.923, "bb_type": "BI", "chi": -168.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.183, 8.586, 1.110 ], "P_xyz": [ -0.091, 10.571, -0.207 ], "form": "A", "ssZp": 4.456, "Dp": 4.586, "splay_angle": 22.564, "splay_distance": 3.477, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 152.642, "theta": 178.324, "eta_prime": 152.242, "theta_prime": -171.947, "eta_base": -153.404, "theta_base": -131.217, "v0": 10.168, "v1": -28.739, "v2": 35.490, "v3": -30.484, "v4": 13.010, "amplitude": 35.522, "phase_angle": 2.405, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.416, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 123.717, 156.811, 124.307 ], "x_axis": [ 0.282, 0.396, 0.874 ], "y_axis": [ -0.956, 0.041, 0.290 ], "z_axis": [ 0.079, -0.918, 0.390 ], "quaternion": [ 0.654, 0.461, -0.304, 0.517 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.059, "beta": 174.259, "gamma": 38.591, "delta": 87.171, "epsilon": -149.298, "zeta": -69.662, "epsilon_zeta": -79.636, "bb_type": "BI", "chi": -159.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.059, 8.491, 0.451 ], "P_xyz": [ 1.540, 8.630, 0.638 ], "form": "A", "ssZp": 4.467, "Dp": 4.691, "splay_angle": 23.810, "splay_distance": 3.932, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 161.598, "theta": -139.772, "eta_prime": 177.083, "theta_prime": -139.532, "eta_base": -131.260, "theta_base": -127.387, "v0": 12.546, "v1": -32.627, "v2": 39.356, "v3": -32.826, "v4": 13.009, "amplitude": 39.357, "phase_angle": 0.313, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.564, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 124.842, 153.997, 126.013 ], "x_axis": [ -0.368, 0.281, 0.887 ], "y_axis": [ -0.919, -0.256, -0.300 ], "z_axis": [ 0.143, -0.925, 0.352 ], "quaternion": [ 0.427, 0.366, -0.436, 0.703 ] } }, { "index": 10, "index_chain": 10, "chain_name": "D", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.203, "beta": 162.590, "gamma": 75.130, "delta": 75.805, "epsilon": -141.876, "zeta": -86.620, "epsilon_zeta": -55.257, "bb_type": "BI", "chi": -164.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.769, 8.834, 0.745 ], "P_xyz": [ 0.678, 9.679, 0.334 ], "form": "A", "ssZp": 4.442, "Dp": 4.613, "splay_angle": 23.156, "splay_distance": 3.684, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 175.478, "theta": -155.907, "eta_prime": -168.540, "theta_prime": -155.529, "eta_base": -139.846, "theta_base": -130.834, "v0": -2.095, "v1": -22.833, "v2": 37.787, "v3": -39.847, "v4": 26.421, "amplitude": 40.580, "phase_angle": 21.381, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.297, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ 126.939, 151.847, 128.550 ], "x_axis": [ -0.707, 0.177, 0.684 ], "y_axis": [ -0.679, -0.437, -0.589 ], "z_axis": [ 0.195, -0.882, 0.430 ], "quaternion": [ 0.267, 0.274, -0.458, 0.802 ] } }, { "index": 11, "index_chain": 11, "chain_name": "D", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.818, "beta": 158.842, "gamma": 57.829, "delta": 80.086, "epsilon": -150.710, "zeta": -75.115, "epsilon_zeta": -75.596, "bb_type": "BI", "chi": -163.981, "glyco_bond": "anti", "C5prime_xyz": [ -1.619, 8.755, 0.724 ], "P_xyz": [ 0.937, 9.251, 0.830 ], "form": "A", "ssZp": 4.335, "Dp": 4.497, "splay_angle": 22.409, "splay_distance": 3.530, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 172.454, "theta": -149.049, "eta_prime": -175.043, "theta_prime": -150.149, "eta_base": -138.482, "theta_base": -124.768, "v0": -1.134, "v1": -21.545, "v2": 34.760, "v3": -36.329, "v4": 23.678, "amplitude": 37.065, "phase_angle": 20.310, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.673, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 128.054, 149.649, 131.288 ], "x_axis": [ -0.972, 0.050, 0.229 ], "y_axis": [ -0.222, -0.506, -0.833 ], "z_axis": [ 0.074, -0.861, 0.503 ], "quaternion": [ 0.079, 0.088, -0.491, 0.863 ] } }, { "index": 12, "index_chain": 12, "chain_name": "D", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -77.965, "beta": 172.798, "gamma": 64.040, "delta": 80.476, "epsilon": -141.463, "zeta": -72.828, "epsilon_zeta": -68.635, "bb_type": "BI", "chi": -159.769, "glyco_bond": "anti", "C5prime_xyz": [ -1.313, 8.710, 0.505 ], "P_xyz": [ 1.270, 9.052, 0.476 ], "form": "A", "ssZp": 4.317, "Dp": 4.623, "splay_angle": 23.832, "splay_distance": 3.860, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 166.483, "theta": -140.308, "eta_prime": 177.646, "theta_prime": -141.696, "eta_base": -143.872, "theta_base": -119.203, "v0": 1.053, "v1": -24.270, "v2": 37.068, "v3": -37.428, "v4": 22.936, "amplitude": 38.778, "phase_angle": 17.075, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.720, "filter_rmsd": 0.039, "frame": { "rmsd": 0.011, "origin": [ 128.196, 147.406, 134.010 ], "x_axis": [ -0.935, -0.180, -0.307 ], "y_axis": [ 0.355, -0.509, -0.784 ], "z_axis": [ -0.015, -0.842, 0.540 ], "quaternion": [ -0.155, -0.093, -0.471, 0.864 ] } }, { "index": 13, "index_chain": 13, "chain_name": "D", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.861, "beta": 163.647, "gamma": 63.671, "delta": 74.326, "epsilon": -151.410, "zeta": -77.802, "epsilon_zeta": -73.607, "bb_type": "BI", "chi": -165.295, "glyco_bond": "anti", "C5prime_xyz": [ -1.657, 8.731, 0.761 ], "P_xyz": [ 0.798, 9.487, 0.329 ], "form": ".", "ssZp": 4.555, "Dp": 4.667, "splay_angle": 27.532, "splay_distance": 4.390, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 159.770, "theta": -157.605, "eta_prime": 176.625, "theta_prime": -158.403, "eta_base": -140.968, "theta_base": -144.560, "v0": 2.974, "v1": -28.223, "v2": 41.571, "v3": -40.672, "v4": 23.859, "amplitude": 42.959, "phase_angle": 14.603, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.725, "filter_rmsd": 0.044, "frame": { "rmsd": 0.013, "origin": [ 126.640, 144.916, 136.516 ], "x_axis": [ -0.641, -0.344, -0.686 ], "y_axis": [ 0.760, -0.409, -0.505 ], "z_axis": [ -0.107, -0.845, 0.524 ], "quaternion": [ -0.344, -0.247, -0.421, 0.802 ] } }, { "index": 14, "index_chain": 14, "chain_name": "D", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.361, "beta": 170.745, "gamma": 65.173, "delta": 75.392, "epsilon": -149.186, "zeta": -75.048, "epsilon_zeta": -74.138, "bb_type": "BI", "chi": -169.759, "glyco_bond": "anti", "C5prime_xyz": [ -1.600, 8.688, 0.994 ], "P_xyz": [ 0.890, 9.405, 0.980 ], "form": "A", "ssZp": 4.603, "Dp": 4.652, "splay_angle": 26.350, "splay_distance": 4.277, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 176.875, "theta": -153.057, "eta_prime": -174.687, "theta_prime": -151.532, "eta_base": -149.770, "theta_base": -133.059, "v0": 0.031, "v1": -25.146, "v2": 39.318, "v3": -40.242, "v4": 25.388, "amplitude": 41.457, "phase_angle": 18.484, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.655, "filter_rmsd": 0.044, "frame": { "rmsd": 0.015, "origin": [ 124.221, 142.722, 139.450 ], "x_axis": [ -0.283, -0.402, -0.871 ], "y_axis": [ 0.950, -0.243, -0.196 ], "z_axis": [ -0.132, -0.883, 0.451 ], "quaternion": [ -0.481, -0.357, -0.384, 0.703 ] } }, { "index": 15, "index_chain": 15, "chain_name": "D", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.013, "beta": 178.410, "gamma": 62.541, "delta": 79.994, "epsilon": -152.101, "zeta": -79.013, "epsilon_zeta": -73.088, "bb_type": "BI", "chi": -160.402, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.904, 0.492 ], "P_xyz": [ 1.083, 9.546, 0.691 ], "form": ".", "ssZp": 4.329, "Dp": 4.495, "splay_angle": 23.575, "splay_distance": 4.353, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 178.799, "theta": -122.529, "eta_prime": -171.692, "theta_prime": -133.752, "eta_base": -144.553, "theta_base": -118.223, "v0": -4.091, "v1": -19.448, "v2": 34.146, "v3": -37.363, "v4": 26.231, "amplitude": 37.571, "phase_angle": 24.655, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.789, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 121.355, 139.918, 140.940 ], "x_axis": [ 0.223, -0.372, -0.901 ], "y_axis": [ 0.961, -0.068, 0.267 ], "z_axis": [ -0.161, -0.926, 0.342 ], "quaternion": [ 0.612, 0.487, 0.302, -0.545 ] } }, { "index": 16, "index_chain": 16, "chain_name": "D", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 126.343, "beta": -157.359, "gamma": -155.547, "delta": 78.897, "epsilon": -148.436, "zeta": -70.809, "epsilon_zeta": -77.627, "bb_type": "BI", "chi": -170.865, "glyco_bond": "anti", "C5prime_xyz": [ -1.330, 8.585, 1.149 ], "P_xyz": [ -0.405, 10.738, 0.027 ], "form": "A", "ssZp": 4.616, "Dp": 4.662, "splay_angle": 26.259, "splay_distance": 4.064, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 165.514, "theta": 178.446, "eta_prime": 179.850, "theta_prime": -170.759, "eta_base": -143.516, "theta_base": -137.540, "v0": 2.789, "v1": -26.351, "v2": 38.692, "v3": -37.949, "v4": 22.191, "amplitude": 39.982, "phase_angle": 14.592, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.077, "filter_rmsd": 0.110, "frame": { "rmsd": 0.018, "origin": [ 119.021, 136.329, 140.152 ], "x_axis": [ 0.594, -0.348, -0.726 ], "y_axis": [ 0.777, 0.011, 0.630 ], "z_axis": [ -0.211, -0.938, 0.277 ], "quaternion": [ 0.686, 0.571, 0.188, -0.410 ] } }, { "index": 17, "index_chain": 17, "chain_name": "D", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.815, "beta": 178.293, "gamma": 66.402, "delta": 81.137, "epsilon": -150.134, "zeta": -67.601, "epsilon_zeta": -82.533, "bb_type": "BI", "chi": -159.917, "glyco_bond": "anti", "C5prime_xyz": [ -1.308, 8.699, 0.539 ], "P_xyz": [ 1.265, 9.055, 0.613 ], "form": "A", "ssZp": 4.339, "Dp": 4.568, "splay_angle": 22.098, "splay_distance": 3.528, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 176.638, "theta": -142.611, "eta_prime": -169.989, "theta_prime": -143.574, "eta_base": -131.961, "theta_base": -120.321, "v0": -0.642, "v1": -21.697, "v2": 34.599, "v3": -35.853, "v4": 23.096, "amplitude": 36.725, "phase_angle": 19.589, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.694, "filter_rmsd": 0.042, "frame": { "rmsd": 0.015, "origin": [ 117.664, 132.596, 139.290 ], "x_axis": [ 0.935, -0.268, -0.234 ], "y_axis": [ 0.283, 0.160, 0.946 ], "z_axis": [ -0.216, -0.950, 0.225 ], "quaternion": [ 0.762, 0.622, 0.006, -0.181 ] } }, { "index": 18, "index_chain": 18, "chain_name": "D", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -95.991, "beta": 168.541, "gamma": 83.626, "delta": 80.367, "epsilon": -145.310, "zeta": -42.564, "epsilon_zeta": -102.746, "bb_type": "BI", "chi": -157.440, "glyco_bond": "anti", "C5prime_xyz": [ -1.516, 8.700, 0.407 ], "P_xyz": [ 0.832, 9.285, -0.503 ], "form": ".", "ssZp": 4.367, "Dp": 4.661, "splay_angle": 24.594, "splay_distance": 4.329, "splay_ratio": 0.226, "d22": 4.461, "d64": 5.395, "eta": 162.195, "theta": -129.402, "eta_prime": 179.156, "theta_prime": -142.715, "eta_base": -140.802, "theta_base": -131.483, "v0": 7.749, "v1": -29.343, "v2": 38.883, "v3": -35.231, "v4": 17.491, "amplitude": 39.213, "phase_angle": 7.441, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.110, "frame": { "rmsd": 0.014, "origin": [ 117.423, 129.124, 138.714 ], "x_axis": [ 0.950, -0.177, 0.258 ], "y_axis": [ -0.242, 0.103, 0.965 ], "z_axis": [ -0.197, -0.979, 0.055 ], "quaternion": [ 0.726, 0.669, -0.157, 0.023 ] } }, { "index": 19, "index_chain": 19, "chain_name": "D", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,coaxial-stack,phosphate", "alpha": -135.466, "beta": 119.763, "gamma": 156.516, "delta": 90.145, "epsilon": -145.374, "zeta": -50.441, "epsilon_zeta": -94.933, "bb_type": "BI", "chi": -173.546, "glyco_bond": "anti", "C5prime_xyz": [ -0.998, 8.212, 1.498 ], "P_xyz": [ -0.117, 10.317, 0.159 ], "form": ".", "ssZp": 4.603, "Dp": 4.654, "splay_angle": 29.529, "splay_distance": 4.624, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": -176.119, "theta": -161.333, "eta_prime": -168.187, "theta_prime": -151.436, "eta_base": -135.822, "theta_base": -106.201, "v0": 13.972, "v1": -31.445, "v2": 36.038, "v3": -28.787, "v4": 9.506, "amplitude": 36.112, "phase_angle": 356.325, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.051, "filter_rmsd": 0.117, "frame": { "rmsd": 0.022, "origin": [ 118.675, 125.288, 137.147 ], "x_axis": [ 0.789, -0.105, 0.605 ], "y_axis": [ -0.599, 0.088, 0.796 ], "z_axis": [ -0.136, -0.991, 0.006 ], "quaternion": [ 0.686, 0.651, -0.270, 0.180 ] } }, { "index": 20, "index_chain": 20, "chain_name": "D", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -86.393, "beta": -178.553, "gamma": 64.060, "delta": 80.149, "epsilon": -133.119, "zeta": -80.721, "epsilon_zeta": -52.398, "bb_type": "BI", "chi": -173.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.666, 1.292 ], "P_xyz": [ 0.982, 9.079, 1.938 ], "form": "A", "ssZp": 4.554, "Dp": 4.646, "splay_angle": 25.337, "splay_distance": 3.992, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 161.339, "theta": -139.407, "eta_prime": -174.310, "theta_prime": -136.296, "eta_base": -111.857, "theta_base": -101.166, "v0": 0.634, "v1": -23.689, "v2": 36.494, "v3": -36.986, "v4": 22.889, "amplitude": 38.279, "phase_angle": 17.565, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.384, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 120.643, 121.295, 138.397 ], "x_axis": [ 0.077, 0.136, 0.988 ], "y_axis": [ -0.972, 0.230, 0.044 ], "z_axis": [ -0.222, -0.964, 0.150 ], "quaternion": [ 0.604, 0.417, -0.501, 0.459 ] } }, { "index": 21, "index_chain": 21, "chain_name": "D", "nt_resnum": 22, "nt_name": "U", "nt_code": "U", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.022, "beta": 168.474, "gamma": 50.494, "delta": 79.839, "epsilon": -142.978, "zeta": -67.505, "epsilon_zeta": -75.474, "bb_type": "BI", "chi": -164.475, "glyco_bond": "anti", "C5prime_xyz": [ -1.350, 8.740, 0.811 ], "P_xyz": [ 1.209, 9.104, 1.274 ], "form": "A", "ssZp": 4.468, "Dp": 4.623, "splay_angle": 24.131, "splay_distance": 3.844, "splay_ratio": 0.210, "d22": 3.961, "d64": 3.895, "eta": 166.952, "theta": -136.184, "eta_prime": -178.831, "theta_prime": -134.233, "eta_base": -130.041, "theta_base": -97.651, "v0": 0.256, "v1": -22.997, "v2": 35.592, "v3": -36.326, "v4": 22.779, "amplitude": 37.450, "phase_angle": 18.123, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.803, "filter_rmsd": 0.109, "frame": { "rmsd": 0.014, "origin": [ 120.973, 117.875, 140.429 ], "x_axis": [ -0.535, 0.426, 0.729 ], "y_axis": [ -0.780, 0.083, -0.621 ], "z_axis": [ -0.325, -0.901, 0.287 ], "quaternion": [ 0.457, 0.153, -0.577, 0.659 ] } }, { "index": 22, "index_chain": 22, "chain_name": "D", "nt_resnum": 23, "nt_name": "U", "nt_code": "U", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -73.361, "beta": 168.456, "gamma": 63.488, "delta": 81.580, "epsilon": -154.762, "zeta": -80.928, "epsilon_zeta": -73.833, "bb_type": "BI", "chi": -162.296, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.732, 0.711 ], "P_xyz": [ 1.062, 9.244, 0.719 ], "form": "A", "ssZp": 4.407, "Dp": 4.534, "splay_angle": 25.776, "splay_distance": 4.089, "splay_ratio": 0.225, "d22": 4.855, "d64": 4.928, "eta": 161.970, "theta": -156.333, "eta_prime": -177.516, "theta_prime": -157.554, "eta_base": -122.492, "theta_base": -145.838, "v0": 0.171, "v1": -23.057, "v2": 35.902, "v3": -36.671, "v4": 23.019, "amplitude": 37.806, "phase_angle": 18.262, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.785, "filter_rmsd": 0.106, "frame": { "rmsd": 0.018, "origin": [ 119.376, 115.693, 143.162 ], "x_axis": [ -0.854, 0.508, 0.110 ], "y_axis": [ -0.280, -0.271, -0.921 ], "z_axis": [ -0.438, -0.818, 0.373 ], "quaternion": [ 0.249, -0.104, -0.550, 0.790 ] } }, { "index": 23, "index_chain": 23, "chain_name": "D", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.341, "beta": 175.837, "gamma": 57.270, "delta": 80.607, "epsilon": -148.170, "zeta": -73.199, "epsilon_zeta": -74.971, "bb_type": "BI", "chi": -162.477, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.752, 0.686 ], "P_xyz": [ 1.095, 9.230, 1.059 ], "form": "A", "ssZp": 4.377, "Dp": 4.552, "splay_angle": 21.536, "splay_distance": 3.429, "splay_ratio": 0.188, "d22": 4.286, "d64": 4.170, "eta": 171.192, "theta": -146.252, "eta_prime": 178.511, "theta_prime": -146.051, "eta_base": -159.393, "theta_base": -120.025, "v0": 0.903, "v1": -23.932, "v2": 36.661, "v3": -36.995, "v4": 22.767, "amplitude": 38.378, "phase_angle": 17.200, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.901, "filter_rmsd": 0.109, "frame": { "rmsd": 0.017, "origin": [ 119.033, 113.032, 146.247 ], "x_axis": [ -0.825, 0.467, -0.318 ], "y_axis": [ 0.085, -0.454, -0.887 ], "z_axis": [ -0.558, -0.759, 0.335 ], "quaternion": [ 0.118, -0.271, -0.509, 0.809 ] } }, { "index": 24, "index_chain": 24, "chain_name": "D", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.850, "beta": 166.841, "gamma": 77.440, "delta": 79.717, "epsilon": -141.834, "zeta": -70.006, "epsilon_zeta": -71.828, "bb_type": "BI", "chi": -164.987, "glyco_bond": "anti", "C5prime_xyz": [ -1.443, 8.733, 0.818 ], "P_xyz": [ 1.098, 9.244, 0.511 ], "form": "A", "ssZp": 4.422, "Dp": 4.602, "splay_angle": 21.803, "splay_distance": 3.583, "splay_ratio": 0.193, "d22": 4.151, "d64": 4.257, "eta": 164.714, "theta": -138.213, "eta_prime": 179.196, "theta_prime": -140.852, "eta_base": -140.026, "theta_base": -113.105, "v0": 1.478, "v1": -24.599, "v2": 37.146, "v3": -37.102, "v4": 22.468, "amplitude": 38.707, "phase_angle": 16.328, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.175, "filter_rmsd": 0.106, "frame": { "rmsd": 0.013, "origin": [ 116.588, 111.633, 148.203 ], "x_axis": [ -0.593, 0.225, -0.773 ], "y_axis": [ 0.451, -0.703, -0.550 ], "z_axis": [ -0.667, -0.675, 0.315 ], "quaternion": [ -0.070, -0.446, -0.379, 0.808 ] } }, { "index": 25, "index_chain": 25, "chain_name": "D", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///D/26", "linked_nts": [ "///D/25", "///D/27" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.444, "beta": 170.067, "gamma": 57.952, "delta": 77.916, "epsilon": -150.412, "zeta": -75.010, "epsilon_zeta": -75.402, "bb_type": "BI", "chi": -159.006, "glyco_bond": "anti", "C5prime_xyz": [ -1.685, 8.832, 0.413 ], "P_xyz": [ 0.820, 9.604, 0.311 ], "form": "A", "ssZp": 4.386, "Dp": 4.592, "splay_angle": 23.771, "splay_distance": 3.864, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 162.791, "theta": -150.677, "eta_prime": 179.878, "theta_prime": -149.915, "eta_base": -133.232, "theta_base": -125.092, "v0": -1.978, "v1": -21.993, "v2": 36.271, "v3": -38.225, "v4": 25.348, "amplitude": 38.935, "phase_angle": 21.316, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.099, "frame": { "rmsd": 0.015, "origin": [ 113.122, 110.875, 148.698 ], "x_axis": [ -0.194, -0.171, -0.966 ], "y_axis": [ 0.618, -0.786, 0.015 ], "z_axis": [ -0.762, -0.594, 0.259 ], "quaternion": [ -0.264, -0.577, -0.193, 0.748 ] } }, { "index": 26, "index_chain": 26, "chain_name": "D", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///D/27", "linked_nts": [ "///D/26", "///D/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.772, "beta": 168.958, "gamma": 66.282, "delta": 79.390, "epsilon": -148.607, "zeta": -71.648, "epsilon_zeta": -76.960, "bb_type": "BI", "chi": -163.143, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.864, 0.655 ], "P_xyz": [ 0.927, 9.512, 0.688 ], "form": "A", "ssZp": 4.356, "Dp": 4.509, "splay_angle": 23.212, "splay_distance": 3.802, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 171.502, "theta": -145.934, "eta_prime": -175.951, "theta_prime": -148.080, "eta_base": -139.204, "theta_base": -125.356, "v0": -2.504, "v1": -20.709, "v2": 34.690, "v3": -37.094, "v4": 24.927, "amplitude": 37.498, "phase_angle": 22.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.695, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 109.416, 109.824, 148.399 ], "x_axis": [ 0.321, -0.412, -0.853 ], "y_axis": [ 0.585, -0.621, 0.521 ], "z_axis": [ -0.744, -0.666, 0.041 ], "quaternion": [ 0.430, 0.689, 0.063, -0.579 ] } }, { "index": 27, "index_chain": 27, "chain_name": "D", "nt_resnum": 28, "nt_name": "U", "nt_code": "U", "nt_id": "///D/28", "linked_nts": [ "///D/27", "///D/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.333, "beta": 171.864, "gamma": 61.795, "delta": 76.814, "epsilon": -147.121, "zeta": -62.285, "epsilon_zeta": -84.836, "bb_type": "BI", "chi": -161.660, "glyco_bond": "anti", "C5prime_xyz": [ -1.568, 8.825, 0.557 ], "P_xyz": [ 0.935, 9.573, 0.448 ], "form": "A", "ssZp": 4.456, "Dp": 4.640, "splay_angle": 24.351, "splay_distance": 4.091, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 161.586, "theta": -140.127, "eta_prime": 174.498, "theta_prime": -141.683, "eta_base": -146.996, "theta_base": -115.052, "v0": -0.369, "v1": -24.073, "v2": 37.994, "v3": -39.065, "v4": 24.828, "amplitude": 40.175, "phase_angle": 18.967, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.800, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ 106.193, 108.193, 147.213 ], "x_axis": [ 0.640, -0.609, -0.469 ], "y_axis": [ 0.298, -0.366, 0.881 ], "z_axis": [ -0.708, -0.704, -0.053 ], "quaternion": [ 0.553, 0.717, -0.108, -0.410 ] } }, { "index": 28, "index_chain": 28, "chain_name": "D", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///D/29", "linked_nts": [ "///D/28", "///D/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -88.865, "beta": 166.537, "gamma": 86.793, "delta": 75.772, "epsilon": -140.225, "zeta": -65.085, "epsilon_zeta": -75.140, "bb_type": "BI", "chi": -174.806, "glyco_bond": "anti", "C5prime_xyz": [ -1.860, 8.727, 1.303 ], "P_xyz": [ 0.505, 9.829, 1.103 ], "form": ".", "ssZp": 4.595, "Dp": 4.618, "splay_angle": 33.060, "splay_distance": 5.123, "splay_ratio": 0.285, "d22": null, "d64": null, "eta": 168.465, "theta": -139.209, "eta_prime": -175.067, "theta_prime": -138.203, "eta_base": -130.989, "theta_base": -92.371, "v0": -3.307, "v1": -21.250, "v2": 36.348, "v3": -39.179, "v4": 26.839, "amplitude": 39.562, "phase_angle": 23.256, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.044, "frame": { "rmsd": 0.011, "origin": [ 104.690, 105.317, 144.721 ], "x_axis": [ 0.827, -0.555, 0.088 ], "y_axis": [ -0.108, -0.003, 0.994 ], "z_axis": [ -0.551, -0.832, -0.062 ], "quaternion": [ 0.664, 0.688, -0.241, -0.168 ] } }, { "index": 29, "index_chain": 29, "chain_name": "D", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///D/30", "linked_nts": [ "///D/29", "///D/31" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -72.348, "beta": 177.714, "gamma": 54.466, "delta": 78.319, "epsilon": -137.558, "zeta": -69.607, "epsilon_zeta": -67.950, "bb_type": "BI", "chi": -174.558, "glyco_bond": "anti", "C5prime_xyz": [ -1.230, 8.609, 1.360 ], "P_xyz": [ 1.316, 8.897, 1.905 ], "form": ".", "ssZp": 4.748, "Dp": 4.742, "splay_angle": 30.493, "splay_distance": 4.819, "splay_ratio": 0.268, "d22": 4.245, "d64": 4.677, "eta": 161.252, "theta": -135.985, "eta_prime": 179.204, "theta_prime": -132.590, "eta_base": -115.555, "theta_base": -102.568, "v0": 3.852, "v1": -27.452, "v2": 39.255, "v3": -37.922, "v4": 21.393, "amplitude": 40.296, "phase_angle": 13.054, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.851, "filter_rmsd": 0.069, "frame": { "rmsd": 0.013, "origin": [ 104.840, 100.197, 144.796 ], "x_axis": [ 0.498, -0.162, 0.852 ], "y_axis": [ -0.663, 0.562, 0.494 ], "z_axis": [ -0.559, -0.811, 0.172 ], "quaternion": [ 0.747, 0.437, -0.472, 0.168 ] } }, { "index": 30, "index_chain": 30, "chain_name": "D", "nt_resnum": 31, "nt_name": "U", "nt_code": "U", "nt_id": "///D/31", "linked_nts": [ "///D/30", "///D/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -64.694, "beta": 176.782, "gamma": 60.047, "delta": 77.659, "epsilon": -150.424, "zeta": -68.906, "epsilon_zeta": -81.518, "bb_type": "BI", "chi": -174.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.685, 1.354 ], "P_xyz": [ 1.046, 9.204, 1.977 ], "form": "A", "ssZp": 4.613, "Dp": 4.614, "splay_angle": 23.594, "splay_distance": 3.722, "splay_ratio": 0.208, "d22": 4.396, "d64": 4.396, "eta": 171.077, "theta": -146.174, "eta_prime": -172.486, "theta_prime": -143.302, "eta_base": -125.922, "theta_base": -110.888, "v0": -0.174, "v1": -23.596, "v2": 37.044, "v3": -37.974, "v4": 24.081, "amplitude": 39.113, "phase_angle": 18.719, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.860, "filter_rmsd": 0.103, "frame": { "rmsd": 0.011, "origin": [ 104.705, 95.729, 146.597 ], "x_axis": [ 0.086, 0.403, 0.911 ], "y_axis": [ -0.765, 0.612, -0.198 ], "z_axis": [ -0.638, -0.680, 0.362 ], "quaternion": [ 0.718, 0.168, -0.540, 0.407 ] } }, { "index": 31, "index_chain": 31, "chain_name": "D", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///D/32", "linked_nts": [ "///D/31", "///D/33" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.089, "beta": 179.594, "gamma": 57.367, "delta": 81.218, "epsilon": -163.760, "zeta": -85.056, "epsilon_zeta": -78.705, "bb_type": "BI", "chi": -164.553, "glyco_bond": "anti", "C5prime_xyz": [ -1.277, 8.779, 0.816 ], "P_xyz": [ 1.281, 9.110, 1.327 ], "form": "A", "ssZp": 4.399, "Dp": 4.460, "splay_angle": 22.379, "splay_distance": 3.645, "splay_ratio": 0.198, "d22": 4.192, "d64": 4.276, "eta": 167.347, "theta": -131.715, "eta_prime": -176.777, "theta_prime": -137.961, "eta_base": -129.692, "theta_base": -109.792, "v0": 0.009, "v1": -22.328, "v2": 34.925, "v3": -35.815, "v4": 22.554, "amplitude": 36.835, "phase_angle": 18.532, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ 103.961, 93.044, 149.065 ], "x_axis": [ -0.365, 0.739, 0.566 ], "y_axis": [ -0.667, 0.217, -0.713 ], "z_axis": [ -0.650, -0.638, 0.414 ], "quaternion": [ 0.562, -0.034, -0.540, 0.625 ] } }, { "index": 32, "index_chain": 32, "chain_name": "D", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///D/33", "linked_nts": [ "///D/32", null ], "nt_type": "RNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 164.704, "beta": -145.729, "gamma": 160.291, "delta": 80.532, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -178.828, "glyco_bond": "anti", "C5prime_xyz": [ -1.313, 8.464, 1.651 ], "P_xyz": [ 0.891, 9.504, 0.713 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 1.993, "v1": -24.163, "v2": 35.918, "v3": -35.744, "v4": 21.230, "amplitude": 37.287, "phase_angle": 15.578, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.343, "filter_rmsd": 0.108, "frame": { "rmsd": 0.011, "origin": [ 102.425, 91.635, 152.055 ], "x_axis": [ -0.634, 0.773, 0.030 ], "y_axis": [ -0.384, -0.281, -0.880 ], "z_axis": [ -0.671, -0.569, 0.475 ], "quaternion": [ 0.374, -0.207, -0.469, 0.773 ] } }, { "index": 33, "index_chain": 33, "chain_name": "D", "nt_resnum": 53, "nt_name": "A", "nt_code": "A", "nt_id": "///D/53", "linked_nts": [ null, "///D/54" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -173.964, "gamma": 61.874, "delta": 82.795, "epsilon": -165.413, "zeta": -93.834, "epsilon_zeta": -71.579, "bb_type": "BI", "chi": -164.976, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.605, 0.851 ], "P_xyz": [ 1.278, 8.834, 1.307 ], "form": "A", "ssZp": 4.435, "Dp": 4.490, "splay_angle": 25.399, "splay_distance": 4.043, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": null, "theta": -139.167, "eta_prime": null, "theta_prime": -144.602, "eta_base": null, "theta_base": -127.474, "v0": 2.606, "v1": -23.813, "v2": 34.799, "v3": -34.298, "v4": 19.979, "amplitude": 35.957, "phase_angle": 14.580, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 102.552, 91.791, 151.761 ], "x_axis": [ -0.565, 0.824, 0.042 ], "y_axis": [ 0.360, 0.200, 0.911 ], "z_axis": [ 0.742, 0.530, -0.409 ], "quaternion": [ 0.237, 0.401, 0.737, 0.489 ] } }, { "index": 34, "index_chain": 34, "chain_name": "D", "nt_resnum": 54, "nt_name": "G", "nt_code": "G", "nt_id": "///D/54", "linked_nts": [ "///D/53", "///D/55" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 168.670, "beta": -142.797, "gamma": 157.384, "delta": 80.720, "epsilon": -129.628, "zeta": -80.441, "epsilon_zeta": -49.187, "bb_type": "BI", "chi": 179.795, "glyco_bond": "anti", "C5prime_xyz": [ -1.187, 8.427, 1.678 ], "P_xyz": [ 1.033, 9.338, 0.631 ], "form": "A", "ssZp": 4.730, "Dp": 4.744, "splay_angle": 24.220, "splay_distance": 3.854, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 162.832, "theta": -146.449, "eta_prime": 176.442, "theta_prime": -147.284, "eta_base": -149.059, "theta_base": -122.795, "v0": 2.933, "v1": -25.066, "v2": 36.640, "v3": -35.844, "v4": 20.745, "amplitude": 37.799, "phase_angle": 14.227, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.161, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 104.335, 93.401, 148.509 ], "x_axis": [ -0.341, 0.804, 0.487 ], "y_axis": [ 0.612, -0.203, 0.764 ], "z_axis": [ 0.713, 0.558, -0.424 ], "quaternion": [ 0.091, 0.567, 0.625, 0.529 ] } }, { "index": 35, "index_chain": 35, "chain_name": "D", "nt_resnum": 55, "nt_name": "A", "nt_code": "A", "nt_id": "///D/55", "linked_nts": [ "///D/54", "///D/56" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -55.332, "beta": 160.037, "gamma": 61.981, "delta": 80.234, "epsilon": -145.029, "zeta": -76.078, "epsilon_zeta": -68.951, "bb_type": "BI", "chi": -167.695, "glyco_bond": "anti", "C5prime_xyz": [ -1.686, 8.740, 0.963 ], "P_xyz": [ 0.859, 9.294, 1.062 ], "form": "A", "ssZp": 4.449, "Dp": 4.547, "splay_angle": 23.631, "splay_distance": 3.712, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 172.984, "theta": -144.781, "eta_prime": -168.636, "theta_prime": -145.041, "eta_base": -126.561, "theta_base": -109.508, "v0": -1.774, "v1": -21.135, "v2": 34.697, "v3": -36.714, "v4": 24.325, "amplitude": 37.246, "phase_angle": 21.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.662, "filter_rmsd": 0.042, "frame": { "rmsd": 0.011, "origin": [ 105.179, 96.510, 146.393 ], "x_axis": [ 0.064, 0.576, 0.815 ], "y_axis": [ 0.730, -0.583, 0.355 ], "z_axis": [ 0.680, 0.573, -0.458 ], "quaternion": [ -0.075, 0.725, 0.450, 0.515 ] } }, { "index": 36, "index_chain": 36, "chain_name": "D", "nt_resnum": 56, "nt_name": "A", "nt_code": "A", "nt_id": "///D/56", "linked_nts": [ "///D/55", "///D/57" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -63.529, "beta": 165.613, "gamma": 54.101, "delta": 80.189, "epsilon": -131.264, "zeta": -62.262, "epsilon_zeta": -69.002, "bb_type": "BI", "chi": -163.654, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.674, 0.735 ], "P_xyz": [ 1.193, 9.010, 0.787 ], "form": ".", "ssZp": 4.474, "Dp": 4.739, "splay_angle": 26.650, "splay_distance": 4.289, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 167.448, "theta": -121.868, "eta_prime": -179.051, "theta_prime": -113.520, "eta_base": -128.617, "theta_base": -77.808, "v0": 3.457, "v1": -26.043, "v2": 37.545, "v3": -36.542, "v4": 20.863, "amplitude": 38.624, "phase_angle": 13.577, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.953, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 107.033, 99.608, 145.531 ], "x_axis": [ 0.500, 0.068, 0.863 ], "y_axis": [ 0.545, -0.800, -0.252 ], "z_axis": [ 0.673, 0.597, -0.437 ], "quaternion": [ -0.257, 0.827, 0.185, 0.464 ] } }, { "index": 37, "index_chain": 37, "chain_name": "D", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///D/57", "linked_nts": [ "///D/56", "///D/58" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,internal-loop", "alpha": -66.936, "beta": -173.416, "gamma": 67.025, "delta": 141.517, "epsilon": -100.532, "zeta": 112.935, "epsilon_zeta": 146.533, "bb_type": "--", "chi": -117.760, "glyco_bond": "anti", "C5prime_xyz": [ -2.138, 8.487, -1.466 ], "P_xyz": [ 0.289, 9.414, -1.289 ], "form": ".", "ssZp": 1.026, "Dp": 1.131, "splay_angle": 52.475, "splay_distance": 9.240, "splay_ratio": 0.442, "d22": null, "d64": null, "eta": -161.523, "theta": 138.414, "eta_prime": -131.430, "theta_prime": 107.175, "eta_base": -90.939, "theta_base": 108.348, "v0": -22.380, "v1": 33.989, "v2": -32.075, "v3": 19.994, "v4": 1.332, "amplitude": 34.335, "phase_angle": 159.095, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.731, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 110.597, 101.175, 147.331 ], "x_axis": [ 0.404, -0.741, 0.537 ], "y_axis": [ 0.330, -0.429, -0.841 ], "z_axis": [ 0.853, 0.517, 0.071 ], "quaternion": [ 0.512, -0.664, 0.154, -0.523 ] } }, { "index": 38, "index_chain": 38, "chain_name": "D", "nt_resnum": 58, "nt_name": "C", "nt_code": "C", "nt_id": "///D/58", "linked_nts": [ "///D/57", "///D/59" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 73.162, "beta": -167.155, "gamma": -171.254, "delta": 85.144, "epsilon": -135.271, "zeta": -53.606, "epsilon_zeta": -81.665, "bb_type": "BI", "chi": -179.019, "glyco_bond": "anti", "C5prime_xyz": [ -1.522, 8.586, 1.665 ], "P_xyz": [ 0.113, 10.564, 1.153 ], "form": ".", "ssZp": 4.191, "Dp": 4.373, "splay_angle": 26.418, "splay_distance": 4.319, "splay_ratio": 0.229, "d22": 4.093, "d64": 3.655, "eta": 153.096, "theta": -144.765, "eta_prime": 135.768, "theta_prime": -137.747, "eta_base": 141.135, "theta_base": -88.077, "v0": -2.327, "v1": -18.135, "v2": 30.410, "v3": -32.596, "v4": 22.044, "amplitude": 32.923, "phase_angle": 22.534, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.349, "filter_rmsd": 0.074, "frame": { "rmsd": 0.020, "origin": [ 102.785, 102.742, 142.653 ], "x_axis": [ 0.503, -0.208, 0.839 ], "y_axis": [ 0.834, -0.138, -0.534 ], "z_axis": [ 0.227, 0.968, 0.104 ], "quaternion": [ 0.606, -0.620, -0.253, -0.430 ] } }, { "index": 39, "index_chain": 39, "chain_name": "D", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///D/59", "linked_nts": [ "///D/58", "///D/60" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -86.104, "beta": -176.076, "gamma": 51.509, "delta": 80.957, "epsilon": -163.332, "zeta": -89.180, "epsilon_zeta": -74.152, "bb_type": "BI", "chi": -150.086, "glyco_bond": "anti", "C5prime_xyz": [ -1.710, 8.807, -0.018 ], "P_xyz": [ 0.762, 9.554, 0.427 ], "form": "A", "ssZp": 4.059, "Dp": 4.401, "splay_angle": 22.285, "splay_distance": 3.812, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 144.723, "theta": -137.428, "eta_prime": 173.385, "theta_prime": -146.219, "eta_base": -120.417, "theta_base": -129.439, "v0": -2.752, "v1": -20.100, "v2": 34.034, "v3": -36.479, "v4": 24.663, "amplitude": 36.889, "phase_angle": 22.690, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.507, "filter_rmsd": 0.103, "frame": { "rmsd": 0.020, "origin": [ 104.942, 105.745, 144.886 ], "x_axis": [ 0.897, -0.431, 0.096 ], "y_axis": [ 0.154, 0.102, -0.983 ], "z_axis": [ 0.414, 0.897, 0.158 ], "quaternion": [ 0.734, -0.640, 0.108, -0.199 ] } }, { "index": 40, "index_chain": 40, "chain_name": "D", "nt_resnum": 60, "nt_name": "A", "nt_code": "A", "nt_id": "///D/60", "linked_nts": [ "///D/59", "///D/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 151.983, "beta": -152.334, "gamma": 174.809, "delta": 80.661, "epsilon": -118.961, "zeta": -91.118, "epsilon_zeta": -27.843, "bb_type": "--", "chi": -174.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.369, 8.548, 1.379 ], "P_xyz": [ 0.454, 10.030, 0.282 ], "form": "A", "ssZp": 4.552, "Dp": 4.674, "splay_angle": 22.609, "splay_distance": 3.672, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 163.600, "theta": -158.157, "eta_prime": 173.160, "theta_prime": -154.581, "eta_base": -155.867, "theta_base": -124.245, "v0": -1.230, "v1": -21.424, "v2": 34.729, "v3": -36.332, "v4": 23.725, "amplitude": 37.065, "phase_angle": 20.454, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.662, "filter_rmsd": 0.046, "frame": { "rmsd": 0.014, "origin": [ 106.567, 108.311, 147.190 ], "x_axis": [ 0.764, -0.528, -0.371 ], "y_axis": [ -0.222, 0.325, -0.919 ], "z_axis": [ 0.606, 0.785, 0.131 ], "quaternion": [ 0.745, -0.572, 0.328, -0.102 ] } }, { "index": 41, "index_chain": 41, "chain_name": "D", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///D/61", "linked_nts": [ "///D/60", "///D/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -46.634, "beta": 150.442, "gamma": 51.036, "delta": 76.489, "epsilon": -148.666, "zeta": -75.679, "epsilon_zeta": -72.986, "bb_type": "BI", "chi": -161.187, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.915, 0.490 ], "P_xyz": [ 0.896, 9.485, 0.283 ], "form": "A", "ssZp": 4.419, "Dp": 4.591, "splay_angle": 22.119, "splay_distance": 3.589, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 161.744, "theta": -148.700, "eta_prime": 179.205, "theta_prime": -150.102, "eta_base": -137.259, "theta_base": -127.053, "v0": -4.107, "v1": -20.944, "v2": 36.534, "v3": -39.816, "v4": 27.784, "amplitude": 40.084, "phase_angle": 24.297, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.301, "filter_rmsd": 0.060, "frame": { "rmsd": 0.008, "origin": [ 109.716, 109.824, 148.320 ], "x_axis": [ 0.464, -0.315, -0.828 ], "y_axis": [ -0.532, 0.649, -0.544 ], "z_axis": [ 0.709, 0.693, 0.133 ], "quaternion": [ 0.749, -0.413, 0.513, 0.072 ] } }, { "index": 42, "index_chain": 42, "chain_name": "D", "nt_resnum": 62, "nt_name": "A", "nt_code": "A", "nt_id": "///D/62", "linked_nts": [ "///D/61", "///D/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.253, "beta": 170.327, "gamma": 53.436, "delta": 79.200, "epsilon": -162.674, "zeta": -94.050, "epsilon_zeta": -68.625, "bb_type": "BI", "chi": -158.426, "glyco_bond": "anti", "C5prime_xyz": [ -1.473, 8.808, 0.430 ], "P_xyz": [ 1.043, 9.438, 0.616 ], "form": "A", "ssZp": 4.283, "Dp": 4.456, "splay_angle": 22.995, "splay_distance": 3.713, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 167.116, "theta": -144.815, "eta_prime": -179.921, "theta_prime": -152.206, "eta_base": -142.309, "theta_base": -129.157, "v0": -0.951, "v1": -22.701, "v2": 36.421, "v3": -37.977, "v4": 24.548, "amplitude": 38.756, "phase_angle": 19.990, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.913, "filter_rmsd": 0.041, "frame": { "rmsd": 0.013, "origin": [ 113.112, 110.907, 148.735 ], "x_axis": [ -0.040, -0.083, -0.996 ], "y_axis": [ -0.628, 0.777, -0.040 ], "z_axis": [ 0.777, 0.624, -0.083 ], "quaternion": [ 0.643, -0.258, 0.689, 0.212 ] } }, { "index": 43, "index_chain": 43, "chain_name": "D", "nt_resnum": 63, "nt_name": "A", "nt_code": "A", "nt_id": "///D/63", "linked_nts": [ "///D/62", "///D/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 139.419, "beta": -156.000, "gamma": -172.227, "delta": 92.420, "epsilon": -116.380, "zeta": -75.113, "epsilon_zeta": -41.267, "bb_type": "--", "chi": -172.668, "glyco_bond": "anti", "C5prime_xyz": [ -0.623, 8.063, 1.423 ], "P_xyz": [ 1.378, 9.377, 0.448 ], "form": "A", "ssZp": 4.526, "Dp": 4.704, "splay_angle": 23.087, "splay_distance": 3.680, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 172.053, "theta": -145.716, "eta_prime": 179.772, "theta_prime": -143.469, "eta_base": -143.432, "theta_base": -114.377, "v0": 16.011, "v1": -31.184, "v2": 34.011, "v3": -25.764, "v4": 6.268, "amplitude": 34.366, "phase_angle": 351.758, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.421, "filter_rmsd": 0.048, "frame": { "rmsd": 0.021, "origin": [ 116.671, 111.764, 148.114 ], "x_axis": [ -0.395, 0.300, -0.868 ], "y_axis": [ -0.472, 0.745, 0.472 ], "z_axis": [ 0.788, 0.596, -0.152 ], "quaternion": [ 0.547, -0.057, 0.757, 0.353 ] } }, { "index": 44, "index_chain": 44, "chain_name": "D", "nt_resnum": 64, "nt_name": "A", "nt_code": "A", "nt_id": "///D/64", "linked_nts": [ "///D/63", "///D/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -68.282, "beta": 157.944, "gamma": 59.857, "delta": 76.085, "epsilon": -146.655, "zeta": -70.415, "epsilon_zeta": -76.240, "bb_type": "BI", "chi": -166.763, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.673, 0.911 ], "P_xyz": [ 1.036, 9.237, 0.649 ], "form": "A", "ssZp": 4.556, "Dp": 4.663, "splay_angle": 23.918, "splay_distance": 4.023, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 149.483, "theta": -145.096, "eta_prime": 173.467, "theta_prime": -147.183, "eta_base": -136.973, "theta_base": -133.321, "v0": 2.731, "v1": -27.536, "v2": 40.700, "v3": -40.041, "v4": 23.480, "amplitude": 42.110, "phase_angle": 14.868, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.331, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ 119.219, 113.388, 146.012 ], "x_axis": [ -0.691, 0.589, -0.419 ], "y_axis": [ -0.105, 0.491, 0.865 ], "z_axis": [ 0.716, 0.641, -0.277 ], "quaternion": [ 0.362, 0.154, 0.784, 0.480 ] } }, { "index": 45, "index_chain": 45, "chain_name": "D", "nt_resnum": 65, "nt_name": "G", "nt_code": "G", "nt_id": "///D/65", "linked_nts": [ "///D/64", "///D/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -77.392, "beta": 179.619, "gamma": 65.300, "delta": 75.897, "epsilon": -149.700, "zeta": -66.392, "epsilon_zeta": -83.308, "bb_type": "BI", "chi": -165.182, "glyco_bond": "anti", "C5prime_xyz": [ -1.789, 8.827, 0.742 ], "P_xyz": [ 0.634, 9.771, 0.852 ], "form": "A", "ssZp": 4.496, "Dp": 4.617, "splay_angle": 24.286, "splay_distance": 3.930, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 167.287, "theta": -146.574, "eta_prime": 177.912, "theta_prime": -144.787, "eta_base": -153.659, "theta_base": -111.018, "v0": 0.071, "v1": -24.971, "v2": 39.039, "v3": -39.902, "v4": 25.150, "amplitude": 41.147, "phase_angle": 18.417, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.646, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 121.080, 114.620, 142.666 ], "x_axis": [ -0.802, 0.592, 0.079 ], "y_axis": [ 0.266, 0.237, 0.934 ], "z_axis": [ 0.534, 0.771, -0.348 ], "quaternion": [ 0.147, 0.278, 0.773, 0.552 ] } }, { "index": 46, "index_chain": 46, "chain_name": "D", "nt_resnum": 66, "nt_name": "A", "nt_code": "A", "nt_id": "///D/66", "linked_nts": [ "///D/65", "///D/67" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -77.480, "beta": 178.644, "gamma": 64.506, "delta": 78.066, "epsilon": -143.918, "zeta": -66.150, "epsilon_zeta": -77.767, "bb_type": "BI", "chi": -160.461, "glyco_bond": "anti", "C5prime_xyz": [ -1.564, 8.792, 0.497 ], "P_xyz": [ 0.953, 9.493, 0.514 ], "form": "A", "ssZp": 4.380, "Dp": 4.629, "splay_angle": 26.621, "splay_distance": 4.344, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 168.314, "theta": -138.465, "eta_prime": -178.231, "theta_prime": -135.665, "eta_base": -131.763, "theta_base": -103.753, "v0": -0.408, "v1": -23.431, "v2": 37.036, "v3": -38.207, "v4": 24.421, "amplitude": 39.208, "phase_angle": 19.161, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.679, "filter_rmsd": 0.043, "frame": { "rmsd": 0.012, "origin": [ 120.900, 117.928, 140.552 ], "x_axis": [ -0.539, 0.491, 0.685 ], "y_axis": [ 0.749, -0.094, 0.656 ], "z_axis": [ 0.386, 0.866, -0.317 ], "quaternion": [ -0.113, 0.467, 0.664, 0.574 ] } }, { "index": 47, "index_chain": 47, "chain_name": "D", "nt_resnum": 67, "nt_name": "U", "nt_code": "U", "nt_id": "///D/67", "linked_nts": [ "///D/66", "///D/68" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -70.209, "beta": 171.736, "gamma": 66.296, "delta": 80.226, "epsilon": -128.484, "zeta": -171.311, "epsilon_zeta": 42.826, "bb_type": "BII", "chi": -155.142, "glyco_bond": "anti", "C5prime_xyz": [ -1.863, 8.831, 0.192 ], "P_xyz": [ 0.581, 9.649, -0.181 ], "form": ".", "ssZp": 4.122, "Dp": 4.620, "splay_angle": 154.419, "splay_distance": 17.966, "splay_ratio": 0.975, "d22": null, "d64": null, "eta": 175.178, "theta": 127.673, "eta_prime": -168.281, "theta_prime": 121.809, "eta_base": -124.149, "theta_base": 141.167, "v0": -2.672, "v1": -20.994, "v2": 35.274, "v3": -37.777, "v4": 25.499, "amplitude": 38.179, "phase_angle": 22.494, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.103, "frame": { "rmsd": 0.011, "origin": [ 120.343, 122.236, 140.598 ], "x_axis": [ -0.018, 0.267, 0.963 ], "y_axis": [ 0.961, -0.263, 0.091 ], "z_axis": [ 0.278, 0.927, -0.252 ], "quaternion": [ -0.342, 0.612, 0.502, 0.507 ] } }, { "index": 48, "index_chain": 48, "chain_name": "D", "nt_resnum": 68, "nt_name": "A", "nt_code": "A", "nt_id": "///D/68", "linked_nts": [ "///D/67", "///D/69" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -63.595, "beta": 95.357, "gamma": -162.641, "delta": 88.470, "epsilon": -116.931, "zeta": -78.672, "epsilon_zeta": -38.259, "bb_type": "--", "chi": 50.123, "glyco_bond": "syn", "C5prime_xyz": [ -5.325, 3.776, 0.953 ], "P_xyz": [ -7.481, 4.549, 2.224 ], "form": ".", "ssZp": -3.007, "Dp": 4.546, "splay_angle": 30.269, "splay_distance": 4.482, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": -51.995, "theta": 173.776, "eta_prime": -79.114, "theta_prime": -162.064, "eta_base": -97.610, "theta_base": -168.896, "v0": 8.645, "v1": -26.935, "v2": 33.741, "v3": -29.760, "v4": 13.435, "amplitude": 33.832, "phase_angle": 4.194, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.023, "origin": [ 135.666, 124.056, 131.395 ], "x_axis": [ 0.201, 0.141, -0.969 ], "y_axis": [ -0.887, -0.395, -0.241 ], "z_axis": [ -0.416, 0.908, 0.045 ], "quaternion": [ -0.461, 0.622, -0.300, -0.557 ] } }, { "index": 49, "index_chain": 49, "chain_name": "D", "nt_resnum": 69, "nt_name": "A", "nt_code": "A", "nt_id": "///D/69", "linked_nts": [ "///D/68", "///D/70" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate", "alpha": -72.769, "beta": -162.001, "gamma": 50.022, "delta": 90.189, "epsilon": -146.891, "zeta": -72.662, "epsilon_zeta": -74.229, "bb_type": "BI", "chi": -123.652, "glyco_bond": "anti", "C5prime_xyz": [ -1.270, 8.341, -1.361 ], "P_xyz": [ 1.341, 8.679, -1.272 ], "form": ".", "ssZp": 2.918, "Dp": 4.513, "splay_angle": 58.734, "splay_distance": 9.559, "splay_ratio": 0.490, "d22": null, "d64": null, "eta": 170.616, "theta": -94.010, "eta_prime": -173.396, "theta_prime": -89.513, "eta_base": 164.649, "theta_base": -69.204, "v0": 10.908, "v1": -27.553, "v2": 32.820, "v3": -27.450, "v4": 10.557, "amplitude": 32.820, "phase_angle": 359.743, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.322, "filter_rmsd": 0.047, "frame": { "rmsd": 0.018, "origin": [ 138.664, 120.814, 130.624 ], "x_axis": [ -0.097, 0.890, 0.445 ], "y_axis": [ -0.639, -0.398, 0.658 ], "z_axis": [ 0.763, -0.221, 0.608 ], "quaternion": [ 0.527, 0.416, 0.151, 0.725 ] } }, { "index": 50, "index_chain": 50, "chain_name": "D", "nt_resnum": 70, "nt_name": "G", "nt_code": "G", "nt_id": "///D/70", "linked_nts": [ "///D/69", "///D/71" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": 142.761, "beta": -124.893, "gamma": -173.029, "delta": 81.373, "epsilon": -133.297, "zeta": -66.167, "epsilon_zeta": -67.130, "bb_type": "BI", "chi": -173.771, "glyco_bond": "anti", "C5prime_xyz": [ -0.853, 8.380, 1.390 ], "P_xyz": [ 0.632, 9.636, -0.345 ], "form": "A", "ssZp": 4.736, "Dp": 4.787, "splay_angle": 24.986, "splay_distance": 4.182, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 179.079, "theta": -150.095, "eta_prime": -142.217, "theta_prime": -152.750, "eta_base": -95.165, "theta_base": -135.573, "v0": 8.564, "v1": -30.632, "v2": 40.016, "v3": -35.974, "v4": 17.359, "amplitude": 40.278, "phase_angle": 6.548, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.263, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 137.855, 123.669, 139.711 ], "x_axis": [ -0.765, -0.010, 0.644 ], "y_axis": [ -0.198, -0.948, -0.250 ], "z_axis": [ 0.613, -0.319, 0.723 ], "quaternion": [ 0.051, 0.339, -0.153, 0.927 ] } }, { "index": 51, "index_chain": 51, "chain_name": "D", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///D/71", "linked_nts": [ "///D/70", "///D/72" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -78.158, "beta": 168.040, "gamma": 75.160, "delta": 72.367, "epsilon": -160.405, "zeta": -69.569, "epsilon_zeta": -90.836, "bb_type": "BI", "chi": -170.334, "glyco_bond": "anti", "C5prime_xyz": [ -1.804, 8.808, 1.030 ], "P_xyz": [ 0.554, 9.810, 0.693 ], "form": "A", "ssZp": 4.601, "Dp": 4.614, "splay_angle": 25.546, "splay_distance": 4.124, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 163.136, "theta": -159.967, "eta_prime": -176.147, "theta_prime": -158.983, "eta_base": -137.475, "theta_base": -141.954, "v0": -1.245, "v1": -25.884, "v2": 41.743, "v3": -43.432, "v4": 28.274, "amplitude": 44.456, "phase_angle": 20.121, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.248, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 139.240, 124.836, 143.480 ], "x_axis": [ -0.778, -0.441, 0.447 ], "y_axis": [ 0.228, -0.862, -0.453 ], "z_axis": [ 0.585, -0.251, 0.771 ], "quaternion": [ -0.181, 0.280, -0.190, 0.923 ] } }, { "index": 52, "index_chain": 52, "chain_name": "D", "nt_resnum": 72, "nt_name": "C", "nt_code": "C", "nt_id": "///D/72", "linked_nts": [ "///D/71", "///D/73" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge,phosphate", "alpha": -83.260, "beta": -175.669, "gamma": 76.752, "delta": 81.155, "epsilon": -151.611, "zeta": -79.974, "epsilon_zeta": -71.637, "bb_type": "BI", "chi": -158.792, "glyco_bond": "anti", "C5prime_xyz": [ -1.579, 8.841, 0.437 ], "P_xyz": [ 0.927, 9.497, 0.348 ], "form": "A", "ssZp": 4.270, "Dp": 4.494, "splay_angle": 21.392, "splay_distance": 3.428, "splay_ratio": 0.186, "d22": 4.805, "d64": 4.583, "eta": 179.639, "theta": -154.905, "eta_prime": -171.704, "theta_prime": -147.329, "eta_base": -147.029, "theta_base": -136.911, "v0": 2.326, "v1": -24.411, "v2": 36.083, "v3": -35.567, "v4": 21.078, "amplitude": 37.369, "phase_angle": 15.073, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.171, "filter_rmsd": 0.067, "frame": { "rmsd": 0.016, "origin": [ 140.295, 126.021, 147.288 ], "x_axis": [ -0.606, -0.775, 0.182 ], "y_axis": [ 0.610, -0.599, -0.519 ], "z_axis": [ 0.511, -0.203, 0.835 ], "quaternion": [ -0.397, 0.199, -0.207, 0.872 ] } }, { "index": 53, "index_chain": 53, "chain_name": "D", "nt_resnum": 73, "nt_name": "U", "nt_code": "U", "nt_id": "///D/73", "linked_nts": [ "///D/72", "///D/74" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,phosphate", "alpha": -59.417, "beta": 176.906, "gamma": 70.159, "delta": 148.319, "epsilon": -126.017, "zeta": -138.911, "epsilon_zeta": 12.894, "bb_type": "--", "chi": -117.765, "glyco_bond": "anti", "C5prime_xyz": [ -2.325, 8.466, -1.272 ], "P_xyz": [ 0.171, 9.267, -1.260 ], "form": ".", "ssZp": 1.710, "Dp": 1.504, "splay_angle": 33.828, "splay_distance": 5.542, "splay_ratio": 0.293, "d22": 6.664, "d64": 7.359, "eta": -165.580, "theta": -120.371, "eta_prime": -137.491, "theta_prime": -179.733, "eta_base": -128.664, "theta_base": 111.747, "v0": -21.192, "v1": 36.156, "v2": -36.447, "v3": 25.109, "v4": -2.675, "amplitude": 37.692, "phase_angle": 165.235, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.711, "filter_rmsd": 0.101, "frame": { "rmsd": 0.018, "origin": [ 141.011, 126.172, 150.636 ], "x_axis": [ -0.394, -0.910, -0.128 ], "y_axis": [ 0.885, -0.339, -0.318 ], "z_axis": [ 0.246, -0.239, 0.939 ], "quaternion": [ 0.549, -0.036, 0.170, -0.817 ] } }, { "index": 54, "index_chain": 54, "chain_name": "D", "nt_resnum": 74, "nt_name": "U", "nt_code": "U", "nt_id": "///D/74", "linked_nts": [ "///D/73", "///D/75" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 60.618, "beta": -146.412, "gamma": 155.616, "delta": 147.657, "epsilon": -141.591, "zeta": -83.421, "epsilon_zeta": -58.170, "bb_type": "BI", "chi": -166.937, "glyco_bond": "anti", "C5prime_xyz": [ -1.949, 8.478, 1.333 ], "P_xyz": [ 0.626, 8.932, 1.491 ], "form": ".", "ssZp": 1.233, "Dp": 1.769, "splay_angle": 76.109, "splay_distance": 11.428, "splay_ratio": 0.617, "d22": 7.550, "d64": 9.196, "eta": 72.714, "theta": -103.422, "eta_prime": 105.103, "theta_prime": -123.798, "eta_base": 60.614, "theta_base": -96.700, "v0": -20.945, "v1": 36.054, "v2": -36.400, "v3": 25.132, "v4": -2.785, "amplitude": 37.606, "phase_angle": 165.448, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.014, "origin": [ 142.093, 131.061, 148.262 ], "x_axis": [ 0.331, -0.014, -0.944 ], "y_axis": [ 0.938, -0.107, 0.330 ], "z_axis": [ -0.106, -0.994, -0.023 ], "quaternion": [ 0.548, 0.604, 0.382, -0.434 ] } }, { "index": 55, "index_chain": 55, "chain_name": "D", "nt_resnum": 75, "nt_name": "C", "nt_code": "C", "nt_id": "///D/75", "linked_nts": [ "///D/74", "///D/76" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -84.358, "beta": -156.864, "gamma": 70.374, "delta": 145.069, "epsilon": -85.948, "zeta": 85.529, "epsilon_zeta": 188.523, "bb_type": "--", "chi": -156.459, "glyco_bond": "anti", "C5prime_xyz": [ -1.600, 8.693, 0.679 ], "P_xyz": [ 0.345, 8.797, 2.419 ], "form": ".", "ssZp": 0.850, "Dp": 0.778, "splay_angle": 34.274, "splay_distance": 5.707, "splay_ratio": 0.312, "d22": null, "d64": null, "eta": -152.472, "theta": 133.602, "eta_prime": -118.802, "theta_prime": 112.520, "eta_base": -90.947, "theta_base": 72.647, "v0": -19.755, "v1": 33.790, "v2": -34.250, "v3": 23.671, "v4": -2.680, "amplitude": 35.371, "phase_angle": 165.534, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.117, "filter_rmsd": 0.064, "frame": { "rmsd": 0.013, "origin": [ 142.011, 121.357, 154.297 ], "x_axis": [ 0.755, -0.162, -0.636 ], "y_axis": [ 0.268, 0.961, 0.073 ], "z_axis": [ 0.599, -0.225, 0.768 ], "quaternion": [ 0.933, 0.080, 0.331, -0.115 ] } }, { "index": 56, "index_chain": 56, "chain_name": "D", "nt_resnum": 76, "nt_name": "A", "nt_code": "A", "nt_id": "///D/76", "linked_nts": [ "///D/75", "///D/77" ], "nt_type": "RNA", "dbn": ")", "summary": "~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,cap-acceptor,splayed-apart", "alpha": 106.608, "beta": -155.240, "gamma": 169.065, "delta": 150.340, "epsilon": -99.305, "zeta": -112.232, "epsilon_zeta": 12.927, "bb_type": "--", "chi": -79.538, "glyco_bond": "--", "C5prime_xyz": [ -2.913, 7.150, -2.769 ], "P_xyz": [ -1.774, 6.249, -4.949 ], "form": ".", "ssZp": 0.518, "Dp": 0.787, "splay_angle": 131.712, "splay_distance": 17.649, "splay_ratio": 0.913, "d22": null, "d64": null, "eta": -148.652, "theta": -108.782, "eta_prime": -164.379, "theta_prime": -147.277, "eta_base": 155.507, "theta_base": 163.211, "v0": -18.888, "v1": 34.719, "v2": -36.317, "v3": 26.411, "v4": -4.978, "amplitude": 37.027, "phase_angle": 168.757, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.016, "origin": [ 141.187, 126.511, 151.989 ], "x_axis": [ -0.294, -0.942, 0.163 ], "y_axis": [ -0.729, 0.331, 0.600 ], "z_axis": [ -0.618, 0.058, -0.784 ], "quaternion": [ -0.252, -0.538, 0.776, 0.212 ] } }, { "index": 57, "index_chain": 57, "chain_name": "D", "nt_resnum": 77, "nt_name": "U", "nt_code": "U", "nt_id": "///D/77", "linked_nts": [ "///D/76", "///D/78" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,bulge,splayed-apart", "alpha": 55.908, "beta": 163.409, "gamma": 80.003, "delta": 84.330, "epsilon": -131.340, "zeta": 49.319, "epsilon_zeta": 179.341, "bb_type": "--", "chi": -151.312, "glyco_bond": "anti", "C5prime_xyz": [ -1.579, 8.724, 0.079 ], "P_xyz": [ 0.821, 9.084, -0.908 ], "form": ".", "ssZp": 4.065, "Dp": 4.637, "splay_angle": 126.879, "splay_distance": 18.060, "splay_ratio": 0.895, "d22": null, "d64": null, "eta": -67.177, "theta": -3.088, "eta_prime": -10.202, "theta_prime": -27.361, "eta_base": 56.347, "theta_base": -70.398, "v0": 7.327, "v1": -27.338, "v2": 35.972, "v3": -32.568, "v4": 16.019, "amplitude": 36.255, "phase_angle": 7.167, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "8d", "suiteness": 0.132, "filter_rmsd": 0.106, "frame": { "rmsd": 0.014, "origin": [ 133.418, 142.349, 151.458 ], "x_axis": [ 0.966, 0.197, -0.169 ], "y_axis": [ 0.248, -0.890, 0.382 ], "z_axis": [ -0.076, -0.411, -0.909 ], "quaternion": [ 0.204, 0.970, 0.115, -0.063 ] } }, { "index": 58, "index_chain": 58, "chain_name": "D", "nt_resnum": 78, "nt_name": "G", "nt_code": "G", "nt_id": "///D/78", "linked_nts": [ "///D/77", "///D/79" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge,phosphate,splayed-apart", "alpha": 147.685, "beta": 142.921, "gamma": -114.649, "delta": 88.307, "epsilon": -144.526, "zeta": -66.751, "epsilon_zeta": -77.775, "bb_type": "BI", "chi": -174.177, "glyco_bond": "anti", "C5prime_xyz": [ -1.095, 8.320, 1.389 ], "P_xyz": [ -0.641, 10.501, 2.745 ], "form": ".", "ssZp": 4.647, "Dp": 4.661, "splay_angle": 27.723, "splay_distance": 4.517, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": -138.680, "theta": -179.613, "eta_prime": -105.985, "theta_prime": -163.842, "eta_base": -43.654, "theta_base": -129.655, "v0": 12.487, "v1": -30.496, "v2": 36.062, "v3": -29.692, "v4": 10.988, "amplitude": 36.070, "phase_angle": 358.811, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 140.031, 125.928, 147.879 ], "x_axis": [ -0.602, -0.785, 0.146 ], "y_axis": [ -0.614, 0.571, 0.545 ], "z_axis": [ -0.511, 0.239, -0.826 ], "quaternion": [ -0.190, -0.404, 0.866, 0.226 ] } }, { "index": 59, "index_chain": 59, "chain_name": "D", "nt_resnum": 79, "nt_name": "C", "nt_code": "C", "nt_id": "///D/79", "linked_nts": [ "///D/78", "///D/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -74.289, "beta": -178.426, "gamma": 65.361, "delta": 76.767, "epsilon": -150.636, "zeta": -74.454, "epsilon_zeta": -76.182, "bb_type": "BI", "chi": -164.239, "glyco_bond": "anti", "C5prime_xyz": [ -1.643, 8.871, 0.734 ], "P_xyz": [ 0.829, 9.615, 1.042 ], "form": "A", "ssZp": 4.434, "Dp": 4.548, "splay_angle": 25.119, "splay_distance": 4.168, "splay_ratio": 0.223, "d22": 4.720, "d64": 5.144, "eta": 171.904, "theta": -153.486, "eta_prime": -172.914, "theta_prime": -154.069, "eta_base": -140.546, "theta_base": -138.308, "v0": -2.411, "v1": -22.469, "v2": 37.368, "v3": -39.716, "v4": 26.499, "amplitude": 40.265, "phase_angle": 21.868, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.652, "filter_rmsd": 0.069, "frame": { "rmsd": 0.013, "origin": [ 139.113, 124.741, 143.619 ], "x_axis": [ -0.807, -0.400, 0.434 ], "y_axis": [ -0.223, 0.888, 0.403 ], "z_axis": [ -0.547, 0.228, -0.806 ], "quaternion": [ -0.262, -0.167, 0.935, 0.169 ] } }, { "index": 60, "index_chain": 60, "chain_name": "D", "nt_resnum": 80, "nt_name": "C", "nt_code": "C", "nt_id": "///D/80", "linked_nts": [ "///D/79", "///D/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": -70.525, "beta": 171.909, "gamma": 63.483, "delta": 74.827, "epsilon": -149.262, "zeta": -68.415, "epsilon_zeta": -80.847, "bb_type": "BI", "chi": -168.650, "glyco_bond": "anti", "C5prime_xyz": [ -1.591, 8.883, 0.858 ], "P_xyz": [ 0.872, 9.739, 0.896 ], "form": "A", "ssZp": 4.572, "Dp": 4.629, "splay_angle": 25.467, "splay_distance": 3.984, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 168.222, "theta": -147.800, "eta_prime": 177.636, "theta_prime": -143.966, "eta_base": -154.661, "theta_base": -106.999, "v0": -2.285, "v1": -23.404, "v2": 38.703, "v3": -40.789, "v4": 27.313, "amplitude": 41.605, "phase_angle": 21.526, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.067, "frame": { "rmsd": 0.014, "origin": [ 137.718, 123.575, 139.868 ], "x_axis": [ -0.780, -0.021, 0.626 ], "y_axis": [ 0.121, 0.976, 0.182 ], "z_axis": [ -0.614, 0.218, -0.758 ], "quaternion": [ -0.331, 0.027, 0.937, 0.107 ] } }, { "index": 61, "index_chain": 61, "chain_name": "D", "nt_resnum": 81, "nt_name": "G", "nt_code": "G", "nt_id": "///D/81", "linked_nts": [ "///D/80", "///D/82" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -62.295, "beta": -167.928, "gamma": 37.470, "delta": 89.397, "epsilon": -140.753, "zeta": -111.947, "epsilon_zeta": -28.806, "bb_type": "--", "chi": -152.162, "glyco_bond": "anti", "C5prime_xyz": [ -1.165, 8.637, 0.200 ], "P_xyz": [ 1.321, 9.063, 0.984 ], "form": ".", "ssZp": 4.200, "Dp": 4.616, "splay_angle": 66.830, "splay_distance": 10.290, "splay_ratio": 0.551, "d22": null, "d64": null, "eta": 172.845, "theta": 173.044, "eta_prime": -176.879, "theta_prime": -158.556, "eta_base": -132.141, "theta_base": -146.928, "v0": 9.384, "v1": -27.682, "v2": 34.453, "v3": -29.984, "v4": 13.117, "amplitude": 34.509, "phase_angle": 3.257, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.442, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 134.011, 123.438, 138.414 ], "x_axis": [ -0.265, 0.558, 0.786 ], "y_axis": [ 0.564, 0.751, -0.343 ], "z_axis": [ -0.782, 0.352, -0.514 ], "quaternion": [ -0.493, 0.353, 0.795, 0.003 ] } }, { "index": 62, "index_chain": 62, "chain_name": "D", "nt_resnum": 82, "nt_name": "A", "nt_code": "A", "nt_id": "///D/82", "linked_nts": [ "///D/81", "///D/83" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -56.836, "beta": -145.581, "gamma": 56.955, "delta": 146.103, "epsilon": -89.874, "zeta": -81.162, "epsilon_zeta": -8.712, "bb_type": "--", "chi": -127.901, "glyco_bond": "anti", "C5prime_xyz": [ -1.365, 8.588, -0.694 ], "P_xyz": [ 0.459, 9.336, 1.017 ], "form": ".", "ssZp": 0.324, "Dp": 0.728, "splay_angle": 127.277, "splay_distance": 17.120, "splay_ratio": 0.897, "d22": null, "d64": null, "eta": -118.693, "theta": -45.568, "eta_prime": -131.524, "theta_prime": -63.756, "eta_base": -155.824, "theta_base": -27.395, "v0": -17.522, "v1": 32.214, "v2": -33.866, "v3": 24.688, "v4": -4.782, "amplitude": 34.500, "phase_angle": 168.997, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.148, "filter_rmsd": 0.044, "frame": { "rmsd": 0.019, "origin": [ 127.550, 125.033, 130.567 ], "x_axis": [ 0.057, -0.214, 0.975 ], "y_axis": [ 0.926, 0.376, 0.029 ], "z_axis": [ -0.372, 0.902, 0.220 ], "quaternion": [ 0.643, -0.340, -0.524, -0.444 ] } }, { "index": 63, "index_chain": 63, "chain_name": "D", "nt_resnum": 83, "nt_name": "A", "nt_code": "A", "nt_id": "///D/83", "linked_nts": [ "///D/82", "///D/84" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -86.475, "beta": -158.500, "gamma": 75.496, "delta": 85.176, "epsilon": -150.164, "zeta": -67.228, "epsilon_zeta": -82.936, "bb_type": "BI", "chi": -154.143, "glyco_bond": "anti", "C5prime_xyz": [ -1.276, 8.616, 0.212 ], "P_xyz": [ 1.331, 8.761, 0.234 ], "form": "A", "ssZp": 4.255, "Dp": 4.600, "splay_angle": 24.944, "splay_distance": 3.895, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 167.202, "theta": -136.041, "eta_prime": -151.501, "theta_prime": -136.595, "eta_base": -144.206, "theta_base": -103.993, "v0": 9.597, "v1": -29.186, "v2": 36.694, "v3": -31.964, "v4": 14.328, "amplitude": 36.775, "phase_angle": 3.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.245, "filter_rmsd": 0.037, "frame": { "rmsd": 0.010, "origin": [ 140.504, 136.001, 128.336 ], "x_axis": [ 0.487, -0.804, 0.341 ], "y_axis": [ -0.717, -0.591, -0.369 ], "z_axis": [ 0.499, -0.065, -0.864 ], "quaternion": [ -0.089, 0.858, -0.443, 0.245 ] } }, { "index": 64, "index_chain": 64, "chain_name": "D", "nt_resnum": 84, "nt_name": "A", "nt_code": "A", "nt_id": "///D/84", "linked_nts": [ "///D/83", "///D/85" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -77.520, "beta": 171.982, "gamma": 69.573, "delta": 80.189, "epsilon": -146.196, "zeta": -64.991, "epsilon_zeta": -81.205, "bb_type": "BI", "chi": -152.590, "glyco_bond": "anti", "C5prime_xyz": [ -1.188, 8.706, 0.063 ], "P_xyz": [ 1.349, 8.974, -0.549 ], "form": ".", "ssZp": 4.188, "Dp": 4.667, "splay_angle": 28.165, "splay_distance": 4.494, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": 168.018, "theta": -136.885, "eta_prime": -174.190, "theta_prime": -135.472, "eta_base": -123.987, "theta_base": -109.293, "v0": 3.496, "v1": -25.856, "v2": 37.241, "v3": -36.105, "v4": 20.612, "amplitude": 38.288, "phase_angle": 13.429, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.523, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 143.416, 134.497, 126.231 ], "x_axis": [ -0.077, -0.996, 0.035 ], "y_axis": [ -0.773, 0.037, -0.634 ], "z_axis": [ 0.630, -0.075, -0.773 ], "quaternion": [ 0.217, -0.644, 0.687, -0.258 ] } }, { "index": 65, "index_chain": 65, "chain_name": "D", "nt_resnum": 85, "nt_name": "U", "nt_code": "U", "nt_id": "///D/85", "linked_nts": [ "///D/84", "///D/86" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -75.993, "beta": 168.134, "gamma": 79.626, "delta": 82.397, "epsilon": -121.516, "zeta": -55.084, "epsilon_zeta": -66.432, "bb_type": "--", "chi": -152.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.694, 8.773, 0.023 ], "P_xyz": [ 0.682, 9.334, -0.874 ], "form": ".", "ssZp": 3.938, "Dp": 4.665, "splay_angle": 52.848, "splay_distance": 8.407, "splay_ratio": 0.445, "d22": 4.108, "d64": 3.972, "eta": -177.845, "theta": -94.103, "eta_prime": -160.465, "theta_prime": -90.694, "eta_base": -121.634, "theta_base": -68.710, "v0": -0.242, "v1": -22.060, "v2": 34.679, "v3": -35.761, "v4": 22.772, "amplitude": 36.673, "phase_angle": 18.983, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.144, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 145.974, 131.753, 123.758 ], "x_axis": [ -0.505, -0.808, -0.305 ], "y_axis": [ -0.506, 0.563, -0.653 ], "z_axis": [ 0.699, -0.176, -0.693 ], "quaternion": [ 0.302, -0.395, 0.831, -0.249 ] } }, { "index": 66, "index_chain": 66, "chain_name": "D", "nt_resnum": 86, "nt_name": "C", "nt_code": "C", "nt_id": "///D/86", "linked_nts": [ "///D/85", "///D/87" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -106.341, "beta": -134.793, "gamma": 70.673, "delta": 140.863, "epsilon": -137.231, "zeta": -148.774, "epsilon_zeta": 11.542, "bb_type": "--", "chi": -122.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.848, 8.608, -1.184 ], "P_xyz": [ 0.394, 9.356, -0.064 ], "form": ".", "ssZp": 2.057, "Dp": 1.967, "splay_angle": 111.119, "splay_distance": 16.877, "splay_ratio": 0.825, "d22": null, "d64": null, "eta": 163.124, "theta": -141.586, "eta_prime": -160.384, "theta_prime": -176.391, "eta_base": -125.831, "theta_base": 170.788, "v0": -21.737, "v1": 33.744, "v2": -32.151, "v3": 20.442, "v4": 0.634, "amplitude": 34.177, "phase_angle": 160.176, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.011, "filter_rmsd": 0.070, "frame": { "rmsd": 0.012, "origin": [ 143.003, 128.846, 116.450 ], "x_axis": [ -0.807, 0.301, 0.508 ], "y_axis": [ 0.330, 0.943, -0.034 ], "z_axis": [ -0.490, 0.140, -0.861 ], "quaternion": [ -0.262, 0.166, 0.950, 0.028 ] } }, { "index": 67, "index_chain": 67, "chain_name": "D", "nt_resnum": 87, "nt_name": "A", "nt_code": "A", "nt_id": "///D/87", "linked_nts": [ "///D/86", "///D/88" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart", "alpha": 49.165, "beta": -147.083, "gamma": 36.994, "delta": 76.480, "epsilon": -176.664, "zeta": -91.570, "epsilon_zeta": -85.094, "bb_type": "BI", "chi": -155.844, "glyco_bond": "anti", "C5prime_xyz": [ -2.066, 8.876, 0.304 ], "P_xyz": [ -0.379, 10.236, 1.735 ], "form": "A", "ssZp": 4.190, "Dp": 4.282, "splay_angle": 24.980, "splay_distance": 3.953, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": -52.740, "theta": -160.223, "eta_prime": -55.734, "theta_prime": -156.550, "eta_base": -48.899, "theta_base": -115.994, "v0": -1.858, "v1": -21.146, "v2": 34.636, "v3": -36.825, "v4": 24.442, "amplitude": 37.225, "phase_angle": 21.495, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.010, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ 155.314, 130.335, 105.002 ], "x_axis": [ 0.337, 0.860, -0.382 ], "y_axis": [ -0.703, 0.500, 0.505 ], "z_axis": [ 0.626, 0.099, 0.774 ], "quaternion": [ 0.808, 0.126, 0.312, 0.484 ] } }, { "index": 68, "index_chain": 68, "chain_name": "D", "nt_resnum": 88, "nt_name": "A", "nt_code": "A", "nt_id": "///D/88", "linked_nts": [ "///D/87", "///D/89" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": 166.599, "beta": -138.111, "gamma": 156.148, "delta": 81.716, "epsilon": -129.042, "zeta": -79.041, "epsilon_zeta": -50.001, "bb_type": "BI", "chi": 179.281, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.352, 1.789 ], "P_xyz": [ 0.904, 9.217, 0.857 ], "form": "A", "ssZp": 4.657, "Dp": 4.697, "splay_angle": 23.996, "splay_distance": 3.820, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 164.437, "theta": -141.792, "eta_prime": 178.776, "theta_prime": -144.889, "eta_base": -130.913, "theta_base": -114.617, "v0": 1.790, "v1": -23.668, "v2": 35.372, "v3": -35.257, "v4": 21.074, "amplitude": 36.767, "phase_angle": 15.833, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.131, "filter_rmsd": 0.043, "frame": { "rmsd": 0.018, "origin": [ 158.714, 131.051, 106.886 ], "x_axis": [ -0.164, 0.986, -0.031 ], "y_axis": [ -0.786, -0.112, 0.608 ], "z_axis": [ 0.596, 0.124, 0.793 ], "quaternion": [ 0.616, 0.197, 0.254, 0.719 ] } }, { "index": 69, "index_chain": 69, "chain_name": "D", "nt_resnum": 89, "nt_name": "C", "nt_code": "C", "nt_id": "///D/89", "linked_nts": [ "///D/88", "///D/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.185, "beta": 164.243, "gamma": 58.368, "delta": 79.770, "epsilon": -151.627, "zeta": -71.226, "epsilon_zeta": -80.401, "bb_type": "BI", "chi": -166.111, "glyco_bond": "anti", "C5prime_xyz": [ -1.437, 8.809, 0.890 ], "P_xyz": [ 1.140, 9.274, 0.971 ], "form": "A", "ssZp": 4.534, "Dp": 4.589, "splay_angle": 22.437, "splay_distance": 3.448, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 163.365, "theta": -143.674, "eta_prime": -177.396, "theta_prime": -145.735, "eta_base": -125.910, "theta_base": -111.809, "v0": -0.594, "v1": -22.649, "v2": 35.962, "v3": -37.119, "v4": 23.778, "amplitude": 38.112, "phase_angle": 19.337, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.742, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 161.566, 133.055, 108.450 ], "x_axis": [ -0.606, 0.695, 0.388 ], "y_axis": [ -0.472, -0.706, 0.528 ], "z_axis": [ 0.641, 0.136, 0.756 ], "quaternion": [ 0.333, 0.294, 0.190, 0.876 ] } }, { "index": 70, "index_chain": 70, "chain_name": "D", "nt_resnum": 90, "nt_name": "A", "nt_code": "A", "nt_id": "///D/90", "linked_nts": [ "///D/89", "///D/91" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -105.914, "beta": 175.865, "gamma": 83.593, "delta": 87.709, "epsilon": -156.828, "zeta": -74.148, "epsilon_zeta": -82.679, "bb_type": "BI", "chi": -173.139, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.426, 1.290 ], "P_xyz": [ 1.296, 8.772, 0.910 ], "form": "A", "ssZp": 4.618, "Dp": 4.603, "splay_angle": 24.677, "splay_distance": 3.782, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 154.833, "theta": -145.597, "eta_prime": 173.362, "theta_prime": -148.034, "eta_base": -131.958, "theta_base": -131.638, "v0": 9.010, "v1": -28.679, "v2": 36.282, "v3": -31.910, "v4": 14.606, "amplitude": 36.395, "phase_angle": 4.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 163.273, 134.869, 110.835 ], "x_axis": [ -0.851, 0.075, 0.520 ], "y_axis": [ 0.056, -0.971, 0.230 ], "z_axis": [ 0.523, 0.225, 0.822 ], "quaternion": [ 0.005, 0.273, 0.119, 0.955 ] } }, { "index": 71, "index_chain": 71, "chain_name": "D", "nt_resnum": 91, "nt_name": "C", "nt_code": "C", "nt_id": "///D/91", "linked_nts": [ "///D/90", "///D/92" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.808, "beta": -166.339, "gamma": 55.496, "delta": 86.789, "epsilon": -167.937, "zeta": -88.165, "epsilon_zeta": -79.772, "bb_type": "BI", "chi": -155.459, "glyco_bond": "anti", "C5prime_xyz": [ -1.236, 8.703, 0.389 ], "P_xyz": [ 1.346, 8.902, 0.947 ], "form": ".", "ssZp": 4.301, "Dp": 4.441, "splay_angle": 31.396, "splay_distance": 5.129, "splay_ratio": 0.273, "d22": 5.264, "d64": 5.575, "eta": 172.652, "theta": -141.327, "eta_prime": -176.066, "theta_prime": -150.493, "eta_base": -145.322, "theta_base": -141.824, "v0": 10.376, "v1": -28.731, "v2": 35.151, "v3": -30.113, "v4": 12.548, "amplitude": 35.170, "phase_angle": 1.882, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.682, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ 164.568, 137.607, 113.099 ], "x_axis": [ -0.721, -0.499, 0.481 ], "y_axis": [ 0.553, -0.832, -0.035 ], "z_axis": [ 0.418, 0.241, 0.876 ], "quaternion": [ -0.284, 0.243, 0.055, 0.926 ] } }, { "index": 72, "index_chain": 72, "chain_name": "D", "nt_resnum": 92, "nt_name": "C", "nt_code": "C", "nt_id": "///D/92", "linked_nts": [ "///D/91", null ], "nt_type": "RNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C3'-endo,non-stack,canonical,helix-end,stem-end", "alpha": 162.766, "beta": -167.963, "gamma": 171.188, "delta": 88.442, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 173.903, "glyco_bond": "anti", "C5prime_xyz": [ -1.065, 8.060, 2.136 ], "P_xyz": [ 1.072, 9.532, 1.798 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 13.664, "v1": -31.030, "v2": 35.831, "v3": -28.751, "v4": 9.563, "amplitude": 35.891, "phase_angle": 356.688, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.604, "filter_rmsd": 0.078, "frame": { "rmsd": 0.020, "origin": [ 165.929, 141.152, 116.546 ], "x_axis": [ -0.602, -0.787, 0.138 ], "y_axis": [ 0.713, -0.607, -0.351 ], "z_axis": [ 0.359, -0.113, 0.926 ], "quaternion": [ -0.424, 0.140, -0.131, 0.885 ] } }, { "index": 73, "index_chain": 73, "chain_name": "D", "nt_resnum": 110, "nt_name": "G", "nt_code": "G", "nt_id": "///D/110", "linked_nts": [ null, "///D/111" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": null, "beta": -140.722, "gamma": 71.958, "delta": 87.697, "epsilon": -136.808, "zeta": -106.924, "epsilon_zeta": -29.884, "bb_type": "--", "chi": -171.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.151, 8.462, 1.118 ], "P_xyz": [ 1.410, 8.216, 1.687 ], "form": ".", "ssZp": 4.724, "Dp": 4.761, "splay_angle": 21.845, "splay_distance": 3.859, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": null, "theta": -128.471, "eta_prime": null, "theta_prime": -140.243, "eta_base": null, "theta_base": -148.582, "v0": 13.613, "v1": -31.712, "v2": 36.796, "v3": -29.809, "v4": 10.389, "amplitude": 36.834, "phase_angle": 357.408, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 164.358, 140.871, 116.036 ], "x_axis": [ -0.545, -0.692, 0.473 ], "y_axis": [ -0.656, 0.704, 0.274 ], "z_axis": [ -0.522, -0.161, -0.838 ], "quaternion": [ -0.283, -0.384, 0.878, 0.032 ] } }, { "index": 74, "index_chain": 74, "chain_name": "D", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///D/111", "linked_nts": [ "///D/110", "///D/112" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 113.096, "beta": -144.834, "gamma": -157.445, "delta": 90.778, "epsilon": -147.527, "zeta": -63.894, "epsilon_zeta": -83.633, "bb_type": "BI", "chi": -174.981, "glyco_bond": "anti", "C5prime_xyz": [ -0.924, 8.246, 1.276 ], "P_xyz": [ 0.330, 10.147, -0.076 ], "form": "A", "ssZp": 4.713, "Dp": 4.722, "splay_angle": 23.193, "splay_distance": 3.605, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 164.411, "theta": -164.150, "eta_prime": 174.216, "theta_prime": -159.081, "eta_base": -172.468, "theta_base": -123.274, "v0": 14.714, "v1": -31.955, "v2": 35.946, "v3": -28.390, "v4": 8.843, "amplitude": 36.076, "phase_angle": 355.124, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 165.564, 138.950, 112.914 ], "x_axis": [ -0.680, -0.497, 0.539 ], "y_axis": [ -0.619, 0.783, -0.059 ], "z_axis": [ -0.392, -0.374, -0.840 ], "quaternion": [ -0.256, -0.307, 0.909, -0.119 ] } }, { "index": 75, "index_chain": 75, "chain_name": "D", "nt_resnum": 112, "nt_name": "U", "nt_code": "U", "nt_id": "///D/112", "linked_nts": [ "///D/111", "///D/113" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -67.708, "beta": 177.942, "gamma": 51.366, "delta": 89.338, "epsilon": -145.232, "zeta": -80.327, "epsilon_zeta": -64.905, "bb_type": "BI", "chi": -163.869, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 8.629, 0.718 ], "P_xyz": [ 1.312, 9.019, 0.842 ], "form": ".", "ssZp": 4.606, "Dp": 4.668, "splay_angle": 33.994, "splay_distance": 5.163, "splay_ratio": 0.293, "d22": null, "d64": null, "eta": 165.494, "theta": -144.476, "eta_prime": -174.192, "theta_prime": -143.086, "eta_base": -122.156, "theta_base": -116.756, "v0": 10.904, "v1": -30.065, "v2": 36.759, "v3": -31.112, "v4": 12.886, "amplitude": 36.772, "phase_angle": 1.534, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.650, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 164.202, 135.960, 111.431 ], "x_axis": [ -0.945, 0.087, 0.317 ], "y_axis": [ -0.077, 0.878, -0.472 ], "z_axis": [ -0.319, -0.470, -0.823 ], "quaternion": [ -0.167, 0.003, 0.955, -0.247 ] } }, { "index": 76, "index_chain": 76, "chain_name": "D", "nt_resnum": 113, "nt_name": "G", "nt_code": "G", "nt_id": "///D/113", "linked_nts": [ "///D/112", "///D/114" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -99.490, "beta": 175.716, "gamma": 83.886, "delta": 86.408, "epsilon": -147.170, "zeta": -83.038, "epsilon_zeta": -64.132, "bb_type": "BI", "chi": -179.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.294, 1.762 ], "P_xyz": [ 1.248, 8.676, 1.661 ], "form": ".", "ssZp": 4.659, "Dp": 4.682, "splay_angle": 31.169, "splay_distance": 4.753, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": 163.741, "theta": -145.506, "eta_prime": 178.073, "theta_prime": -141.492, "eta_base": -138.988, "theta_base": -127.565, "v0": 10.190, "v1": -30.074, "v2": 37.321, "v3": -32.280, "v4": 13.961, "amplitude": 37.371, "phase_angle": 2.979, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 161.489, 132.864, 108.316 ], "x_axis": [ -0.669, 0.702, 0.243 ], "y_axis": [ 0.579, 0.698, -0.422 ], "z_axis": [ -0.466, -0.141, -0.873 ], "quaternion": [ -0.197, 0.356, 0.900, -0.156 ] } }, { "index": 77, "index_chain": 77, "chain_name": "D", "nt_resnum": 114, "nt_name": "U", "nt_code": "U", "nt_id": "///D/114", "linked_nts": [ "///D/113", "///D/115" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": -52.141, "beta": 167.768, "gamma": 81.370, "delta": 145.714, "epsilon": -147.318, "zeta": -88.543, "epsilon_zeta": -58.776, "bb_type": "BI", "chi": -149.038, "glyco_bond": "anti", "C5prime_xyz": [ -1.883, 8.733, 0.421 ], "P_xyz": [ 0.659, 9.071, 1.122 ], "form": ".", "ssZp": 1.604, "Dp": 1.904, "splay_angle": 25.751, "splay_distance": 4.374, "splay_ratio": 0.225, "d22": 6.151, "d64": 6.037, "eta": -164.624, "theta": -68.936, "eta_prime": -128.316, "theta_prime": -131.928, "eta_base": -109.367, "theta_base": -154.280, "v0": -19.337, "v1": 34.288, "v2": -35.275, "v3": 24.949, "v4": -3.712, "amplitude": 36.196, "phase_angle": 167.050, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.244, "filter_rmsd": 0.100, "frame": { "rmsd": 0.009, "origin": [ 157.934, 130.671, 106.049 ], "x_axis": [ -0.295, 0.955, 0.024 ], "y_axis": [ 0.851, 0.274, -0.448 ], "z_axis": [ -0.435, -0.112, -0.894 ], "quaternion": [ -0.146, 0.576, 0.785, -0.178 ] } }, { "index": 78, "index_chain": 78, "chain_name": "D", "nt_resnum": 115, "nt_name": "U", "nt_code": "U", "nt_id": "///D/115", "linked_nts": [ "///D/114", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": 124.707, "beta": 157.259, "gamma": 157.463, "delta": 86.220, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -121.332, "glyco_bond": "anti", "C5prime_xyz": [ -1.899, 8.407, -1.553 ], "P_xyz": [ -1.513, 9.043, -4.080 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 9.201, "v1": -26.436, "v2": 32.709, "v3": -28.346, "v4": 12.203, "amplitude": 32.748, "phase_angle": 2.793, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.011, "origin": [ 155.694, 126.957, 105.482 ], "x_axis": [ -0.142, 0.985, -0.100 ], "y_axis": [ 0.654, 0.017, -0.756 ], "z_axis": [ -0.743, -0.173, -0.646 ], "quaternion": [ -0.239, 0.610, 0.672, -0.346 ] } }, { "index": 79, "index_chain": 1, "chain_name": "E", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/11", "linked_nts": [ null, "///E/12" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 138.488, "gamma": 117.830, "delta": 162.067, "epsilon": -157.636, "zeta": -151.880, "epsilon_zeta": -5.756, "bb_type": "--", "chi": -99.266, "glyco_bond": "anti", "C5prime_xyz": [ -1.942, 8.039, -1.918 ], "P_xyz": [ -0.073, 7.514, -3.676 ], "form": ".", "ssZp": 1.546, "Dp": 1.637, "splay_angle": 25.969, "splay_distance": 4.149, "splay_ratio": 0.232, "d22": 5.886, "d64": 4.482, "eta": null, "theta": -133.333, "eta_prime": null, "theta_prime": 179.402, "eta_base": null, "theta_base": -128.633, "v0": -16.827, "v1": 39.522, "v2": -46.173, "v3": 37.503, "v4": -13.266, "amplitude": 46.208, "phase_angle": 177.752, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 125.522, 83.455, 99.834 ], "x_axis": [ 0.155, 0.467, -0.871 ], "y_axis": [ -0.980, 0.186, -0.075 ], "z_axis": [ 0.127, 0.865, 0.486 ], "quaternion": [ 0.676, -0.348, 0.369, 0.535 ] } }, { "index": 80, "index_chain": 2, "chain_name": "E", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 162.918, "beta": -162.029, "gamma": 163.549, "delta": 159.688, "epsilon": -171.439, "zeta": -94.479, "epsilon_zeta": -76.960, "bb_type": "BI", "chi": -103.843, "glyco_bond": "anti", "C5prime_xyz": [ -1.486, 8.043, -1.637 ], "P_xyz": [ 0.575, 7.719, -3.219 ], "form": ".", "ssZp": 1.691, "Dp": 1.746, "splay_angle": 20.901, "splay_distance": 3.728, "splay_ratio": 0.187, "d22": 4.007, "d64": 3.909, "eta": 150.717, "theta": -110.244, "eta_prime": -161.968, "theta_prime": -157.670, "eta_base": -118.727, "theta_base": -120.213, "v0": -7.296, "v1": 30.269, "v2": -40.449, "v3": 37.252, "v4": -19.080, "amplitude": 40.906, "phase_angle": 188.573, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 124.655, 86.882, 102.007 ], "x_axis": [ -0.578, 0.474, -0.664 ], "y_axis": [ -0.786, -0.103, 0.610 ], "z_axis": [ 0.220, 0.874, 0.432 ], "quaternion": [ 0.433, -0.153, 0.510, 0.727 ] } }, { "index": 81, "index_chain": 3, "chain_name": "E", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.355, "beta": -178.504, "gamma": 18.372, "delta": 144.286, "epsilon": -134.834, "zeta": -153.281, "epsilon_zeta": 18.447, "bb_type": "--", "chi": -94.593, "glyco_bond": "anti", "C5prime_xyz": [ -2.877, 7.980, -2.279 ], "P_xyz": [ -1.277, 10.056, -2.468 ], "form": "B", "ssZp": 1.804, "Dp": 1.806, "splay_angle": 22.505, "splay_distance": 3.771, "splay_ratio": 0.198, "d22": 4.720, "d64": 3.821, "eta": 167.859, "theta": -172.603, "eta_prime": -165.902, "theta_prime": -173.044, "eta_base": -126.132, "theta_base": -119.868, "v0": -31.457, "v1": 44.745, "v2": -40.101, "v3": 23.015, "v4": 4.993, "amplitude": 44.333, "phase_angle": 154.760, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 125.068, 90.529, 102.656 ], "x_axis": [ -0.914, 0.259, -0.312 ], "y_axis": [ -0.382, -0.288, 0.878 ], "z_axis": [ 0.137, 0.922, 0.362 ], "quaternion": [ 0.200, -0.055, 0.562, 0.801 ] } }, { "index": 82, "index_chain": 4, "chain_name": "E", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.700, "beta": 133.090, "gamma": 71.148, "delta": 127.113, "epsilon": -170.874, "zeta": -102.164, "epsilon_zeta": -68.709, "bb_type": "BI", "chi": -123.217, "glyco_bond": "anti", "C5prime_xyz": [ -2.340, 8.730, -1.405 ], "P_xyz": [ 0.190, 9.036, -1.956 ], "form": "B", "ssZp": 2.184, "Dp": 2.300, "splay_angle": 21.886, "splay_distance": 3.668, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 166.518, "theta": -134.263, "eta_prime": -163.564, "theta_prime": -159.178, "eta_base": -110.519, "theta_base": -111.366, "v0": -33.556, "v1": 38.005, "v2": -28.119, "v3": 9.605, "v4": 14.790, "amplitude": 37.583, "phase_angle": 138.433, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 124.995, 93.681, 104.725 ], "x_axis": [ -0.944, 0.023, 0.331 ], "y_axis": [ 0.298, -0.375, 0.878 ], "z_axis": [ 0.144, 0.927, 0.347 ], "quaternion": [ -0.084, 0.145, 0.552, 0.816 ] } }, { "index": 83, "index_chain": 5, "chain_name": "E", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.128, "beta": 179.076, "gamma": 37.672, "delta": 130.850, "epsilon": -166.356, "zeta": -91.580, "epsilon_zeta": -74.775, "bb_type": "BI", "chi": -111.468, "glyco_bond": "anti", "C5prime_xyz": [ -2.055, 8.299, -1.869 ], "P_xyz": [ 0.195, 9.604, -1.597 ], "form": "B", "ssZp": 2.155, "Dp": 2.379, "splay_angle": 19.736, "splay_distance": 3.391, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 171.447, "theta": -145.784, "eta_prime": -167.511, "theta_prime": -160.331, "eta_base": -112.863, "theta_base": -131.316, "v0": -28.213, "v1": 33.906, "v2": -26.906, "v3": 11.281, "v4": 10.536, "amplitude": 33.490, "phase_angle": 143.456, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.011, "origin": [ 124.861, 96.954, 106.376 ], "x_axis": [ -0.501, -0.225, 0.836 ], "y_axis": [ 0.856, -0.276, 0.438 ], "z_axis": [ 0.132, 0.935, 0.330 ], "quaternion": [ -0.372, 0.333, 0.473, 0.726 ] } }, { "index": 84, "index_chain": 6, "chain_name": "E", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -115.917, "beta": 128.267, "gamma": 133.533, "delta": 127.810, "epsilon": -146.058, "zeta": -114.739, "epsilon_zeta": -31.319, "bb_type": "BI", "chi": -153.417, "glyco_bond": "anti", "C5prime_xyz": [ -2.095, 8.868, -0.027 ], "P_xyz": [ -0.427, 9.787, -1.756 ], "form": "B", "ssZp": 2.192, "Dp": 2.180, "splay_angle": 17.421, "splay_distance": 3.088, "splay_ratio": 0.155, "d22": 4.925, "d64": 4.259, "eta": -155.556, "theta": -161.483, "eta_prime": -155.851, "theta_prime": -162.761, "eta_base": -124.524, "theta_base": -126.165, "v0": -34.342, "v1": 37.134, "v2": -26.358, "v3": 7.254, "v4": 16.909, "amplitude": 37.278, "phase_angle": 134.996, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.019, "origin": [ 125.014, 100.270, 107.067 ], "x_axis": [ -0.062, -0.242, 0.968 ], "y_axis": [ 0.995, -0.091, 0.041 ], "z_axis": [ 0.078, 0.966, 0.246 ], "quaternion": [ 0.523, -0.442, -0.426, -0.591 ] } }, { "index": 85, "index_chain": 7, "chain_name": "E", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 84.143, "beta": -165.276, "gamma": -125.264, "delta": 158.102, "epsilon": -178.534, "zeta": -100.644, "epsilon_zeta": -77.890, "bb_type": "BI", "chi": -114.902, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.286, -1.154 ], "P_xyz": [ -0.251, 9.909, -2.769 ], "form": "B", "ssZp": 1.685, "Dp": 1.815, "splay_angle": 19.032, "splay_distance": 3.246, "splay_ratio": 0.169, "d22": 4.624, "d64": 3.992, "eta": 172.981, "theta": -158.174, "eta_prime": -162.608, "theta_prime": -164.565, "eta_base": -124.242, "theta_base": -127.246, "v0": -11.884, "v1": 33.363, "v2": -41.017, "v3": 35.048, "v4": -14.895, "amplitude": 41.045, "phase_angle": 182.130, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 124.350, 103.106, 108.094 ], "x_axis": [ 0.545, -0.174, 0.820 ], "y_axis": [ 0.828, 0.266, -0.494 ], "z_axis": [ -0.132, 0.948, 0.289 ], "quaternion": [ 0.725, -0.498, -0.328, -0.346 ] } }, { "index": 86, "index_chain": 8, "chain_name": "E", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 162.778, "beta": 170.428, "gamma": 172.708, "delta": 158.379, "epsilon": -151.520, "zeta": -139.849, "epsilon_zeta": -11.671, "bb_type": "--", "chi": -115.612, "glyco_bond": "anti", "C5prime_xyz": [ -1.959, 8.435, -1.188 ], "P_xyz": [ -0.359, 9.507, -2.900 ], "form": "B", "ssZp": 1.296, "Dp": 1.673, "splay_angle": 21.241, "splay_distance": 3.508, "splay_ratio": 0.185, "d22": 4.853, "d64": 4.061, "eta": -179.829, "theta": -166.013, "eta_prime": -158.931, "theta_prime": -164.226, "eta_base": -124.391, "theta_base": -116.764, "v0": -20.884, "v1": 41.438, "v2": -45.576, "v3": 34.681, "v4": -9.064, "amplitude": 45.974, "phase_angle": 172.456, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.016, "origin": [ 123.608, 105.871, 109.624 ], "x_axis": [ 0.924, -0.040, 0.380 ], "y_axis": [ 0.356, 0.451, -0.818 ], "z_axis": [ -0.139, 0.891, 0.431 ], "quaternion": [ 0.838, -0.510, -0.155, -0.118 ] } }, { "index": 87, "index_chain": 9, "chain_name": "E", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 24.403, "beta": 150.506, "gamma": -32.243, "delta": 169.458, "epsilon": -90.236, "zeta": 177.622, "epsilon_zeta": 92.143, "bb_type": "BII", "chi": -71.117, "glyco_bond": "anti", "C5prime_xyz": [ -2.409, 7.024, -2.791 ], "P_xyz": [ -0.822, 9.073, -3.160 ], "form": "B", "ssZp": 0.137, "Dp": 0.234, "splay_angle": 24.645, "splay_distance": 4.108, "splay_ratio": 0.214, "d22": 4.602, "d64": 3.622, "eta": -175.148, "theta": -150.352, "eta_prime": -148.609, "theta_prime": -154.829, "eta_base": -108.035, "theta_base": -101.990, "v0": -12.293, "v1": 38.032, "v2": -47.825, "v3": 42.040, "v4": -18.808, "amplitude": 47.948, "phase_angle": 184.089, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 123.555, 109.016, 111.176 ], "x_axis": [ 0.935, 0.295, -0.196 ], "y_axis": [ -0.321, 0.470, -0.822 ], "z_axis": [ -0.150, 0.832, 0.535 ], "quaternion": [ 0.857, -0.482, 0.013, 0.180 ] } }, { "index": 88, "index_chain": 10, "chain_name": "E", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/20", "linked_nts": [ "///E/19", "///E/21" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -50.471, "beta": 130.056, "gamma": 15.328, "delta": 147.417, "epsilon": -94.698, "zeta": 161.644, "epsilon_zeta": 103.658, "bb_type": "BII", "chi": -71.655, "glyco_bond": "anti", "C5prime_xyz": [ -3.553, 7.342, -2.735 ], "P_xyz": [ -1.388, 8.570, -3.605 ], "form": "B", "ssZp": 1.198, "Dp": 1.157, "splay_angle": 22.645, "splay_distance": 3.851, "splay_ratio": 0.198, "d22": 4.889, "d64": 4.003, "eta": 173.153, "theta": -176.884, "eta_prime": -161.607, "theta_prime": 172.072, "eta_base": -115.687, "theta_base": -146.437, "v0": -33.145, "v1": 48.088, "v2": -43.258, "v3": 25.409, "v4": 4.599, "amplitude": 47.505, "phase_angle": 155.589, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 122.810, 113.038, 111.561 ], "x_axis": [ 0.554, 0.487, -0.675 ], "y_axis": [ -0.823, 0.198, -0.533 ], "z_axis": [ -0.126, 0.851, 0.510 ], "quaternion": [ 0.752, -0.460, 0.182, 0.435 ] } }, { "index": 89, "index_chain": 11, "chain_name": "E", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/21", "linked_nts": [ "///E/20", "///E/22" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.212, "beta": 142.978, "gamma": 42.972, "delta": 137.240, "epsilon": -159.859, "zeta": -114.678, "epsilon_zeta": -45.181, "bb_type": "BI", "chi": -103.419, "glyco_bond": "anti", "C5prime_xyz": [ -2.651, 8.180, -2.161 ], "P_xyz": [ -0.222, 9.111, -2.413 ], "form": "B", "ssZp": 1.921, "Dp": 2.044, "splay_angle": 19.935, "splay_distance": 3.321, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 170.377, "theta": -137.427, "eta_prime": -171.344, "theta_prime": -154.053, "eta_base": -133.380, "theta_base": -109.395, "v0": -32.349, "v1": 42.250, "v2": -35.964, "v3": 18.346, "v4": 8.403, "amplitude": 41.650, "phase_angle": 149.709, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.459, "filter_rmsd": 0.105, "frame": { "rmsd": 0.010, "origin": [ 121.504, 115.923, 113.752 ], "x_axis": [ 0.059, 0.507, -0.860 ], "y_axis": [ -0.988, -0.091, -0.121 ], "z_axis": [ -0.140, 0.857, 0.496 ], "quaternion": [ 0.605, -0.404, 0.297, 0.618 ] } }, { "index": 90, "index_chain": 12, "chain_name": "E", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/22", "linked_nts": [ "///E/21", "///E/23" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -69.396, "beta": 167.122, "gamma": 55.197, "delta": 138.165, "epsilon": -140.447, "zeta": -145.976, "epsilon_zeta": 5.529, "bb_type": "--", "chi": -98.061, "glyco_bond": "anti", "C5prime_xyz": [ -2.811, 8.021, -2.257 ], "P_xyz": [ -0.518, 9.121, -2.848 ], "form": "B", "ssZp": 1.731, "Dp": 1.830, "splay_angle": 21.766, "splay_distance": 3.702, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 172.225, "theta": -161.715, "eta_prime": -165.019, "theta_prime": -169.925, "eta_base": -118.394, "theta_base": -132.348, "v0": -29.205, "v1": 39.889, "v2": -34.930, "v3": 19.184, "v4": 5.884, "amplitude": 39.354, "phase_angle": 152.571, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 120.551, 119.004, 114.543 ], "x_axis": [ -0.533, 0.246, -0.809 ], "y_axis": [ -0.843, -0.229, 0.486 ], "z_axis": [ -0.065, 0.942, 0.330 ], "quaternion": [ 0.377, -0.302, 0.494, 0.723 ] } }, { "index": 91, "index_chain": 13, "chain_name": "E", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/23", "linked_nts": [ "///E/22", "///E/24" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,splayed-apart", "alpha": -59.900, "beta": 144.595, "gamma": 54.548, "delta": 139.072, "epsilon": -123.283, "zeta": -40.000, "epsilon_zeta": -83.283, "bb_type": "--", "chi": -103.853, "glyco_bond": "anti", "C5prime_xyz": [ -2.563, 8.287, -1.990 ], "P_xyz": [ -0.085, 8.881, -2.494 ], "form": ".", "ssZp": 1.531, "Dp": 1.570, "splay_angle": 144.885, "splay_distance": 20.060, "splay_ratio": 0.953, "d22": null, "d64": null, "eta": -178.932, "theta": -23.008, "eta_prime": -161.257, "theta_prime": -76.995, "eta_base": -126.600, "theta_base": -89.948, "v0": -30.059, "v1": 41.123, "v2": -35.595, "v3": 19.415, "v4": 6.345, "amplitude": 40.293, "phase_angle": 152.056, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 120.012, 122.144, 116.428 ], "x_axis": [ -0.901, 0.050, -0.431 ], "y_axis": [ -0.428, -0.261, 0.865 ], "z_axis": [ -0.069, 0.964, 0.257 ], "quaternion": [ 0.154, -0.161, 0.588, 0.778 ] } }, { "index": 92, "index_chain": 14, "chain_name": "E", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/24", "linked_nts": [ "///E/23", "///E/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -177.877, "beta": 171.750, "gamma": -88.969, "delta": 156.186, "epsilon": 175.559, "zeta": -89.438, "epsilon_zeta": -95.003, "bb_type": "BI", "chi": -111.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.824, 8.267, -1.412 ], "P_xyz": [ -1.226, 10.695, -2.075 ], "form": ".", "ssZp": 2.179, "Dp": 2.113, "splay_angle": 23.702, "splay_distance": 4.434, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": -90.471, "theta": -164.608, "eta_prime": -32.369, "theta_prime": -179.750, "eta_base": -7.800, "theta_base": -155.610, "v0": -16.663, "v1": 37.096, "v2": -41.767, "v3": 33.236, "v4": -10.657, "amplitude": 41.890, "phase_angle": 175.611, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ 118.464, 124.971, 136.227 ], "x_axis": [ 0.865, -0.203, 0.459 ], "y_axis": [ 0.424, -0.191, -0.885 ], "z_axis": [ 0.267, 0.960, -0.079 ], "quaternion": [ 0.631, -0.731, -0.076, -0.248 ] } }, { "index": 93, "index_chain": 15, "chain_name": "E", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/25", "linked_nts": [ "///E/24", "///E/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -157.828, "beta": 142.419, "gamma": 153.942, "delta": 83.282, "epsilon": -150.025, "zeta": -77.290, "epsilon_zeta": -72.735, "bb_type": "BI", "chi": -164.232, "glyco_bond": "anti", "C5prime_xyz": [ -1.914, 8.866, 0.580 ], "P_xyz": [ -1.239, 10.665, -1.213 ], "form": ".", "ssZp": 4.186, "Dp": 4.310, "splay_angle": 22.560, "splay_distance": 3.647, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 176.298, "theta": 172.027, "eta_prime": 172.197, "theta_prime": -176.608, "eta_base": -156.873, "theta_base": -133.343, "v0": -10.941, "v1": -14.210, "v2": 32.163, "v3": -39.319, "v4": 32.010, "amplitude": 39.032, "phase_angle": 34.511, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 117.808, 128.953, 138.064 ], "x_axis": [ 0.995, 0.076, 0.063 ], "y_axis": [ 0.069, -0.078, -0.995 ], "z_axis": [ -0.071, 0.994, -0.083 ], "quaternion": [ 0.677, -0.734, -0.049, 0.003 ] } }, { "index": 94, "index_chain": 16, "chain_name": "E", "nt_resnum": 26, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/26", "linked_nts": [ "///E/25", "///E/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.144, "beta": 164.859, "gamma": 56.403, "delta": 84.830, "epsilon": -168.688, "zeta": -75.255, "epsilon_zeta": -93.432, "bb_type": "BI", "chi": -152.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 8.840, 0.019 ], "P_xyz": [ 1.028, 9.294, -0.244 ], "form": "A", "ssZp": 4.153, "Dp": 4.396, "splay_angle": 24.777, "splay_distance": 3.925, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 164.275, "theta": -154.349, "eta_prime": -177.187, "theta_prime": -158.412, "eta_base": -124.667, "theta_base": -143.718, "v0": -2.871, "v1": -21.432, "v2": 36.007, "v3": -38.116, "v4": 26.379, "amplitude": 38.977, "phase_angle": 22.515, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.913, "filter_rmsd": 0.107, "frame": { "rmsd": 0.011, "origin": [ 118.645, 132.488, 138.388 ], "x_axis": [ 0.817, 0.066, -0.573 ], "y_axis": [ -0.574, -0.007, -0.819 ], "z_axis": [ -0.058, 0.998, 0.032 ], "quaternion": [ 0.679, -0.669, 0.190, 0.236 ] } }, { "index": 95, "index_chain": 17, "chain_name": "E", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/27", "linked_nts": [ "///E/26", "///E/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -110.485, "beta": -176.774, "gamma": 83.297, "delta": 89.269, "epsilon": -146.132, "zeta": -38.109, "epsilon_zeta": -108.023, "bb_type": "BI", "chi": -165.889, "glyco_bond": "anti", "C5prime_xyz": [ -1.369, 8.602, 0.922 ], "P_xyz": [ 1.212, 8.999, 0.744 ], "form": ".", "ssZp": 4.437, "Dp": 4.531, "splay_angle": 24.522, "splay_distance": 4.369, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 163.712, "theta": -123.821, "eta_prime": 172.845, "theta_prime": -143.147, "eta_base": -159.826, "theta_base": -145.718, "v0": 7.168, "v1": -28.356, "v2": 37.565, "v3": -34.127, "v4": 17.268, "amplitude": 37.917, "phase_angle": 7.816, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.014, "origin": [ 118.719, 136.195, 139.675 ], "x_axis": [ 0.481, -0.225, -0.847 ], "y_axis": [ -0.873, -0.031, -0.488 ], "z_axis": [ 0.083, 0.974, -0.211 ], "quaternion": [ 0.557, -0.656, 0.418, 0.291 ] } }, { "index": 96, "index_chain": 18, "chain_name": "E", "nt_resnum": 28, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/28", "linked_nts": [ "///E/27", "///E/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -145.482, "beta": 100.298, "gamma": 159.267, "delta": 93.391, "epsilon": -123.733, "zeta": -77.622, "epsilon_zeta": -46.111, "bb_type": "--", "chi": -171.120, "glyco_bond": "anti", "C5prime_xyz": [ -0.941, 8.276, 1.431 ], "P_xyz": [ -0.447, 10.414, 0.040 ], "form": "A", "ssZp": 4.537, "Dp": 4.672, "splay_angle": 27.002, "splay_distance": 4.466, "splay_ratio": 0.238, "d22": 4.644, "d64": 4.934, "eta": 171.597, "theta": -176.590, "eta_prime": 174.970, "theta_prime": -164.274, "eta_base": -171.004, "theta_base": -139.927, "v0": 15.873, "v1": -33.581, "v2": 37.785, "v3": -29.269, "v4": 8.495, "amplitude": 37.975, "phase_angle": 354.260, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.066, "frame": { "rmsd": 0.014, "origin": [ 121.387, 139.437, 140.884 ], "x_axis": [ 0.247, -0.287, -0.926 ], "y_axis": [ -0.945, 0.140, -0.295 ], "z_axis": [ 0.214, 0.948, -0.237 ], "quaternion": [ 0.536, -0.580, 0.531, 0.307 ] } }, { "index": 97, "index_chain": 19, "chain_name": "E", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/29", "linked_nts": [ "///E/28", "///E/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.873, "beta": 167.140, "gamma": 52.359, "delta": 78.126, "epsilon": -152.217, "zeta": -68.013, "epsilon_zeta": -84.204, "bb_type": "BI", "chi": -163.328, "glyco_bond": "anti", "C5prime_xyz": [ -1.794, 8.890, 0.582 ], "P_xyz": [ 0.638, 9.776, 0.752 ], "form": "A", "ssZp": 4.399, "Dp": 4.535, "splay_angle": 23.940, "splay_distance": 3.977, "splay_ratio": 0.212, "d22": 4.344, "d64": 4.492, "eta": 163.013, "theta": -145.829, "eta_prime": -178.399, "theta_prime": -143.941, "eta_base": -144.965, "theta_base": -115.334, "v0": -4.828, "v1": -22.882, "v2": 39.940, "v3": -43.781, "v4": 30.786, "amplitude": 43.959, "phase_angle": 24.690, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.458, "filter_rmsd": 0.103, "frame": { "rmsd": 0.013, "origin": [ 124.216, 142.657, 139.628 ], "x_axis": [ -0.278, -0.320, -0.906 ], "y_axis": [ -0.946, 0.256, 0.199 ], "z_axis": [ 0.168, 0.912, -0.374 ], "quaternion": [ 0.389, -0.458, 0.691, 0.402 ] } }, { "index": 98, "index_chain": 20, "chain_name": "E", "nt_resnum": 30, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/30", "linked_nts": [ "///E/29", "///E/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.324, "beta": 175.517, "gamma": 61.844, "delta": 83.051, "epsilon": -162.493, "zeta": -84.118, "epsilon_zeta": -78.375, "bb_type": "BI", "chi": -156.630, "glyco_bond": "anti", "C5prime_xyz": [ -1.786, 8.909, 0.137 ], "P_xyz": [ 0.682, 9.776, 0.097 ], "form": ".", "ssZp": 4.169, "Dp": 4.318, "splay_angle": 26.523, "splay_distance": 4.388, "splay_ratio": 0.231, "d22": 4.950, "d64": 5.303, "eta": 171.255, "theta": -162.637, "eta_prime": -172.876, "theta_prime": -163.465, "eta_base": -132.066, "theta_base": -153.306, "v0": -11.505, "v1": -13.871, "v2": 32.071, "v3": -39.552, "v4": 32.469, "amplitude": 39.253, "phase_angle": 35.211, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.105, "frame": { "rmsd": 0.015, "origin": [ 125.638, 144.834, 136.620 ], "x_axis": [ -0.771, -0.227, -0.595 ], "y_axis": [ -0.619, 0.484, 0.618 ], "z_axis": [ 0.147, 0.845, -0.514 ], "quaternion": [ 0.223, -0.254, 0.832, 0.440 ] } }, { "index": 99, "index_chain": 21, "chain_name": "E", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/31", "linked_nts": [ "///E/30", "///E/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.832, "beta": 165.838, "gamma": 59.955, "delta": 83.735, "epsilon": -154.117, "zeta": -76.151, "epsilon_zeta": -77.966, "bb_type": "BI", "chi": -159.656, "glyco_bond": "anti", "C5prime_xyz": [ -1.882, 8.906, 0.299 ], "P_xyz": [ 0.589, 9.751, 0.291 ], "form": "A", "ssZp": 4.174, "Dp": 4.321, "splay_angle": 23.054, "splay_distance": 3.768, "splay_ratio": 0.200, "d22": 4.444, "d64": 4.326, "eta": 177.349, "theta": -149.825, "eta_prime": -174.341, "theta_prime": -151.439, "eta_base": -156.881, "theta_base": -121.194, "v0": -11.850, "v1": -13.535, "v2": 31.815, "v3": -39.407, "v4": 32.588, "amplitude": 39.167, "phase_angle": 35.681, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.747, "filter_rmsd": 0.106, "frame": { "rmsd": 0.012, "origin": [ 128.198, 147.301, 134.048 ], "x_axis": [ -0.923, -0.100, -0.370 ], "y_axis": [ -0.363, 0.539, 0.760 ], "z_axis": [ 0.123, 0.836, -0.534 ], "quaternion": [ 0.143, -0.134, 0.865, 0.461 ] } }, { "index": 100, "index_chain": 22, "chain_name": "E", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/32", "linked_nts": [ "///E/31", "///E/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -73.712, "beta": 164.544, "gamma": 62.783, "delta": 80.759, "epsilon": -154.495, "zeta": -70.719, "epsilon_zeta": -83.776, "bb_type": "BI", "chi": -160.738, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 8.861, 0.426 ], "P_xyz": [ 0.924, 9.486, 0.091 ], "form": "A", "ssZp": 4.375, "Dp": 4.556, "splay_angle": 23.212, "splay_distance": 3.756, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 163.364, "theta": -145.996, "eta_prime": 178.119, "theta_prime": -146.866, "eta_base": -136.807, "theta_base": -119.766, "v0": -5.105, "v1": -21.704, "v2": 38.634, "v3": -42.175, "v4": 30.202, "amplitude": 42.673, "phase_angle": 25.132, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.787, "filter_rmsd": 0.107, "frame": { "rmsd": 0.011, "origin": [ 128.169, 149.688, 131.131 ], "x_axis": [ -0.974, 0.191, 0.126 ], "y_axis": [ 0.212, 0.553, 0.805 ], "z_axis": [ 0.084, 0.811, -0.579 ], "quaternion": [ -0.012, 0.114, 0.881, 0.459 ] } }, { "index": 101, "index_chain": 23, "chain_name": "E", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/33", "linked_nts": [ "///E/32", "///E/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -68.024, "beta": 167.797, "gamma": 62.777, "delta": 83.287, "epsilon": -149.579, "zeta": -86.578, "epsilon_zeta": -63.001, "bb_type": "BI", "chi": -160.978, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.814, 0.498 ], "P_xyz": [ 0.892, 9.458, 0.437 ], "form": "A", "ssZp": 4.286, "Dp": 4.478, "splay_angle": 23.145, "splay_distance": 3.805, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 171.896, "theta": -153.362, "eta_prime": -172.705, "theta_prime": -154.142, "eta_base": -130.968, "theta_base": -138.970, "v0": -4.350, "v1": -20.598, "v2": 36.164, "v3": -39.427, "v4": 27.822, "amplitude": 39.780, "phase_angle": 24.618, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.823, "filter_rmsd": 0.040, "frame": { "rmsd": 0.011, "origin": [ 126.877, 152.004, 128.472 ], "x_axis": [ -0.706, 0.362, 0.609 ], "y_axis": [ 0.706, 0.426, 0.565 ], "z_axis": [ -0.055, 0.829, -0.557 ], "quaternion": [ -0.203, 0.326, 0.820, 0.425 ] } }, { "index": 102, "index_chain": 24, "chain_name": "E", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/34", "linked_nts": [ "///E/33", "///E/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -49.459, "beta": 159.844, "gamma": 49.891, "delta": 78.984, "epsilon": -172.890, "zeta": -90.323, "epsilon_zeta": -82.567, "bb_type": "BI", "chi": -156.950, "glyco_bond": "anti", "C5prime_xyz": [ -1.769, 8.923, 0.103 ], "P_xyz": [ 0.739, 9.637, -0.026 ], "form": "A", "ssZp": 4.158, "Dp": 4.318, "splay_angle": 23.405, "splay_distance": 3.814, "splay_ratio": 0.205, "d22": 4.300, "d64": 4.524, "eta": 169.484, "theta": -143.506, "eta_prime": -176.813, "theta_prime": -149.100, "eta_base": -148.559, "theta_base": -118.401, "v0": -9.608, "v1": -17.665, "v2": 36.754, "v3": -43.001, "v4": 33.564, "amplitude": 42.969, "phase_angle": 31.200, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.660, "filter_rmsd": 0.108, "frame": { "rmsd": 0.014, "origin": [ 125.519, 154.037, 125.555 ], "x_axis": [ -0.366, 0.516, 0.774 ], "y_axis": [ 0.921, 0.323, 0.219 ], "z_axis": [ -0.137, 0.793, -0.594 ], "quaternion": [ -0.302, 0.476, 0.755, 0.335 ] } }, { "index": 103, "index_chain": 25, "chain_name": "E", "nt_resnum": 35, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/35", "linked_nts": [ "///E/34", "///E/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 159.236, "beta": -145.196, "gamma": 169.593, "delta": 92.068, "epsilon": -110.911, "zeta": -101.479, "epsilon_zeta": -9.432, "bb_type": "--", "chi": -172.658, "glyco_bond": "anti", "C5prime_xyz": [ -1.150, 8.543, 1.271 ], "P_xyz": [ 0.820, 9.551, -0.084 ], "form": "A", "ssZp": 4.368, "Dp": 4.531, "splay_angle": 21.973, "splay_distance": 3.755, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": -179.808, "theta": -131.110, "eta_prime": -169.947, "theta_prime": -142.648, "eta_base": -126.665, "theta_base": -117.733, "v0": 4.604, "v1": -23.709, "v2": 33.046, "v3": -30.933, "v4": 16.794, "amplitude": 33.643, "phase_angle": 10.807, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.473, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 123.562, 157.104, 124.411 ], "x_axis": [ 0.198, 0.615, 0.763 ], "y_axis": [ 0.954, 0.058, -0.294 ], "z_axis": [ -0.225, 0.786, -0.575 ], "quaternion": [ -0.412, 0.655, 0.599, 0.205 ] } }, { "index": 104, "index_chain": 26, "chain_name": "E", "nt_resnum": 36, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/36", "linked_nts": [ "///E/35", "///E/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 86.318, "beta": -137.525, "gamma": -142.592, "delta": 99.720, "epsilon": -115.843, "zeta": -104.042, "epsilon_zeta": -11.801, "bb_type": "--", "chi": -177.761, "glyco_bond": "anti", "C5prime_xyz": [ -0.937, 7.965, 1.725 ], "P_xyz": [ 0.490, 9.974, 0.925 ], "form": "A", "ssZp": 4.491, "Dp": 4.590, "splay_angle": 21.119, "splay_distance": 3.453, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 162.736, "theta": -167.718, "eta_prime": 176.270, "theta_prime": -150.411, "eta_base": -139.420, "theta_base": -128.959, "v0": 14.911, "v1": -28.416, "v2": 30.651, "v3": -22.764, "v4": 5.192, "amplitude": 31.055, "phase_angle": 350.745, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 122.077, 160.520, 123.935 ], "x_axis": [ 0.723, 0.277, 0.633 ], "y_axis": [ 0.691, -0.254, -0.677 ], "z_axis": [ -0.027, 0.927, -0.375 ], "quaternion": [ 0.523, -0.767, -0.316, -0.198 ] } }, { "index": 105, "index_chain": 27, "chain_name": "E", "nt_resnum": 37, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/37", "linked_nts": [ "///E/36", "///E/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -21.007, "beta": 134.729, "gamma": 45.137, "delta": 119.381, "epsilon": -171.750, "zeta": -92.233, "epsilon_zeta": -79.516, "bb_type": "BI", "chi": -145.937, "glyco_bond": "anti", "C5prime_xyz": [ -2.340, 8.932, -0.297 ], "P_xyz": [ 0.084, 9.565, 0.417 ], "form": ".", "ssZp": 2.685, "Dp": 2.719, "splay_angle": 21.863, "splay_distance": 3.837, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 163.298, "theta": -107.865, "eta_prime": -157.914, "theta_prime": -134.619, "eta_base": -128.090, "theta_base": -97.742, "v0": -35.441, "v1": 34.688, "v2": -21.244, "v3": 1.343, "v4": 21.366, "amplitude": 36.185, "phase_angle": 125.951, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 121.283, 163.874, 124.127 ], "x_axis": [ 0.952, -0.049, 0.303 ], "y_axis": [ 0.282, -0.249, -0.927 ], "z_axis": [ 0.121, 0.967, -0.223 ], "quaternion": [ 0.608, -0.778, -0.075, -0.136 ] } }, { "index": 106, "index_chain": 28, "chain_name": "E", "nt_resnum": 38, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/38", "linked_nts": [ "///E/37", "///E/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -168.973, "beta": -157.352, "gamma": 119.279, "delta": 79.781, "epsilon": -152.703, "zeta": -32.449, "epsilon_zeta": -120.254, "bb_type": "BI", "chi": -156.098, "glyco_bond": "anti", "C5prime_xyz": [ -2.455, 9.049, -0.018 ], "P_xyz": [ -0.392, 10.203, -1.079 ], "form": ".", "ssZp": 4.054, "Dp": 4.190, "splay_angle": 21.453, "splay_distance": 3.851, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 140.609, "theta": -132.366, "eta_prime": 161.536, "theta_prime": -152.487, "eta_base": -141.592, "theta_base": -136.255, "v0": -20.683, "v1": -6.438, "v2": 29.437, "v3": -42.318, "v4": 40.242, "amplitude": 43.080, "phase_angle": 46.897, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.010, "origin": [ 122.749, 167.407, 124.426 ], "x_axis": [ 0.904, -0.248, -0.347 ], "y_axis": [ -0.388, -0.140, -0.911 ], "z_axis": [ 0.177, 0.959, -0.223 ], "quaternion": [ 0.621, -0.753, 0.211, 0.056 ] } }, { "index": 107, "index_chain": 29, "chain_name": "E", "nt_resnum": 39, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/39", "linked_nts": [ "///E/38", "///E/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -142.258, "beta": 100.114, "gamma": 153.616, "delta": 91.078, "epsilon": -147.747, "zeta": -83.557, "epsilon_zeta": -64.190, "bb_type": "BI", "chi": -178.324, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.520, 1.604 ], "P_xyz": [ -0.792, 10.482, 0.016 ], "form": "A", "ssZp": 4.206, "Dp": 4.205, "splay_angle": 22.604, "splay_distance": 3.740, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 172.453, "theta": -171.276, "eta_prime": 173.653, "theta_prime": -166.826, "eta_base": -156.183, "theta_base": -135.056, "v0": -0.697, "v1": -16.640, "v2": 26.657, "v3": -27.889, "v4": 18.136, "amplitude": 28.392, "phase_angle": 20.137, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 124.951, 170.560, 124.635 ], "x_axis": [ 0.535, -0.665, -0.521 ], "y_axis": [ -0.700, -0.003, -0.715 ], "z_axis": [ 0.473, 0.747, -0.467 ], "quaternion": [ 0.516, -0.708, 0.482, 0.017 ] } }, { "index": 108, "index_chain": 30, "chain_name": "E", "nt_resnum": 40, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/40", "linked_nts": [ "///E/39", "///E/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 160.951, "beta": -164.880, "gamma": 158.408, "delta": 87.733, "epsilon": -113.003, "zeta": -37.872, "epsilon_zeta": -75.131, "bb_type": "--", "chi": -171.861, "glyco_bond": "anti", "C5prime_xyz": [ -1.135, 8.507, 1.386 ], "P_xyz": [ 1.035, 9.652, 0.578 ], "form": "A", "ssZp": 4.356, "Dp": 4.561, "splay_angle": 20.529, "splay_distance": 3.534, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 152.223, "theta": -124.494, "eta_prime": 170.274, "theta_prime": -139.109, "eta_base": -148.072, "theta_base": -125.798, "v0": 5.292, "v1": -24.468, "v2": 33.248, "v3": -31.224, "v4": 16.347, "amplitude": 33.748, "phase_angle": 9.874, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.238, "filter_rmsd": 0.067, "frame": { "rmsd": 0.012, "origin": [ 127.916, 172.698, 123.842 ], "x_axis": [ -0.093, -0.643, -0.760 ], "y_axis": [ -0.858, 0.439, -0.266 ], "z_axis": [ 0.505, 0.628, -0.592 ], "quaternion": [ 0.434, -0.515, 0.729, 0.124 ] } }, { "index": 109, "index_chain": 31, "chain_name": "E", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/41", "linked_nts": [ "///E/40", "///E/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -126.210, "beta": 92.786, "gamma": 147.952, "delta": 90.764, "epsilon": -113.980, "zeta": -73.090, "epsilon_zeta": -40.890, "bb_type": "--", "chi": -176.608, "glyco_bond": "anti", "C5prime_xyz": [ -1.135, 8.204, 1.691 ], "P_xyz": [ -0.530, 10.063, 0.015 ], "form": ".", "ssZp": 4.572, "Dp": 4.667, "splay_angle": 30.735, "splay_distance": 5.090, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 163.007, "theta": -163.588, "eta_prime": 173.979, "theta_prime": -153.611, "eta_base": -157.236, "theta_base": -131.036, "v0": 13.140, "v1": -30.193, "v2": 34.741, "v3": -27.962, "v4": 9.620, "amplitude": 34.791, "phase_angle": 356.921, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 130.770, 173.547, 121.938 ], "x_axis": [ -0.497, -0.546, -0.674 ], "y_axis": [ -0.709, 0.704, -0.048 ], "z_axis": [ 0.501, 0.454, -0.737 ], "quaternion": [ 0.343, -0.366, 0.857, 0.118 ] } }, { "index": 110, "index_chain": 32, "chain_name": "E", "nt_resnum": 42, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/42", "linked_nts": [ "///E/41", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -84.262, "beta": 173.681, "gamma": 69.004, "delta": 87.075, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -167.352, "glyco_bond": "anti", "C5prime_xyz": [ -1.961, 8.898, 0.575 ], "P_xyz": [ 0.446, 9.817, 1.033 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -22.150, "v1": -0.433, "v2": 20.865, "v3": -34.240, "v4": 35.957, "amplitude": 36.431, "phase_angle": 55.060, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.186, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 133.362, 173.828, 117.566 ], "x_axis": [ -0.947, -0.303, -0.103 ], "y_axis": [ -0.318, 0.856, 0.408 ], "z_axis": [ -0.036, 0.420, -0.907 ], "quaternion": [ 0.017, -0.161, 0.963, 0.215 ] } }, { "index": 111, "index_chain": 1, "chain_name": "G", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/1", "linked_nts": [ null, "///G/2" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 164.747, "gamma": -48.206, "delta": 167.030, "epsilon": -167.024, "zeta": -114.748, "epsilon_zeta": -52.277, "bb_type": "BI", "chi": -82.030, "glyco_bond": "anti", "C5prime_xyz": [ -1.571, 7.138, -2.374 ], "P_xyz": [ 0.090, 9.135, -2.717 ], "form": "B", "ssZp": 0.938, "Dp": 1.284, "splay_angle": 22.059, "splay_distance": 3.767, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": null, "theta": -144.733, "eta_prime": null, "theta_prime": -151.603, "eta_base": null, "theta_base": -105.303, "v0": 7.252, "v1": 20.175, "v2": -38.120, "v3": 43.586, "v4": -32.347, "amplitude": 43.270, "phase_angle": 208.239, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 120.059, 122.167, 116.673 ], "x_axis": [ -0.874, 0.026, -0.486 ], "y_axis": [ 0.470, 0.305, -0.829 ], "z_axis": [ 0.127, -0.952, -0.278 ], "quaternion": [ 0.195, 0.158, 0.784, -0.568 ] } }, { "index": 112, "index_chain": 2, "chain_name": "G", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/2", "linked_nts": [ "///G/1", "///G/3" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.774, "beta": 153.091, "gamma": 47.128, "delta": 136.931, "epsilon": -102.819, "zeta": -177.698, "epsilon_zeta": 74.880, "bb_type": "BII", "chi": -95.384, "glyco_bond": "anti", "C5prime_xyz": [ -3.302, 7.984, -2.258 ], "P_xyz": [ -1.146, 9.198, -3.121 ], "form": ".", "ssZp": 1.391, "Dp": 1.311, "splay_angle": 21.411, "splay_distance": 3.701, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -175.530, "theta": -177.890, "eta_prime": -152.237, "theta_prime": -179.998, "eta_base": -110.416, "theta_base": -137.578, "v0": -38.122, "v1": 46.736, "v2": -36.988, "v3": 16.219, "v4": 13.281, "amplitude": 45.569, "phase_angle": 144.260, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.009, "origin": [ 120.370, 119.145, 114.446 ], "x_axis": [ -0.476, 0.188, -0.859 ], "y_axis": [ 0.876, 0.187, -0.444 ], "z_axis": [ 0.078, -0.964, -0.254 ], "quaternion": [ 0.338, 0.384, 0.692, -0.508 ] } }, { "index": 113, "index_chain": 3, "chain_name": "G", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/3", "linked_nts": [ "///G/2", "///G/4" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -71.544, "beta": 141.813, "gamma": 42.953, "delta": 141.782, "epsilon": -153.936, "zeta": -105.899, "epsilon_zeta": -48.037, "bb_type": "BI", "chi": -101.559, "glyco_bond": "anti", "C5prime_xyz": [ -2.089, 8.062, -2.202 ], "P_xyz": [ 0.463, 8.572, -2.157 ], "form": "B", "ssZp": 1.498, "Dp": 1.807, "splay_angle": 18.849, "splay_distance": 3.296, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 165.169, "theta": -112.510, "eta_prime": -172.602, "theta_prime": -135.170, "eta_base": -132.555, "theta_base": -103.330, "v0": -25.307, "v1": 38.204, "v2": -36.240, "v3": 22.493, "v4": 1.452, "amplitude": 38.778, "phase_angle": 159.154, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.429, "filter_rmsd": 0.042, "frame": { "rmsd": 0.017, "origin": [ 121.931, 115.819, 113.999 ], "x_axis": [ 0.111, 0.392, -0.913 ], "y_axis": [ 0.991, 0.027, 0.132 ], "z_axis": [ 0.076, -0.920, -0.385 ], "quaternion": [ 0.434, 0.606, 0.570, -0.345 ] } }, { "index": 114, "index_chain": 4, "chain_name": "G", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/4", "linked_nts": [ "///G/3", "///G/5" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -35.691, "beta": 165.416, "gamma": 7.466, "delta": 137.462, "epsilon": -93.526, "zeta": 133.424, "epsilon_zeta": 133.050, "bb_type": "BII", "chi": -78.175, "glyco_bond": "anti", "C5prime_xyz": [ -3.487, 7.421, -2.632 ], "P_xyz": [ -2.041, 9.271, -3.716 ], "form": ".", "ssZp": 1.016, "Dp": 1.135, "splay_angle": 22.425, "splay_distance": 4.015, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 175.961, "theta": 164.662, "eta_prime": -161.351, "theta_prime": 164.756, "eta_base": -127.579, "theta_base": -141.308, "v0": -34.932, "v1": 43.635, "v2": -34.828, "v3": 15.742, "v4": 11.779, "amplitude": 42.433, "phase_angle": 145.162, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 122.571, 113.386, 111.870 ], "x_axis": [ 0.533, 0.465, -0.707 ], "y_axis": [ 0.846, -0.318, 0.429 ], "z_axis": [ -0.026, -0.826, -0.563 ], "quaternion": [ 0.404, 0.777, 0.422, -0.236 ] } }, { "index": 115, "index_chain": 5, "chain_name": "G", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/5", "linked_nts": [ "///G/4", "///G/6" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 88.649, "beta": -139.006, "gamma": -178.094, "delta": 159.580, "epsilon": -161.135, "zeta": -113.445, "epsilon_zeta": -47.690, "bb_type": "BI", "chi": -114.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.259, -1.173 ], "P_xyz": [ 0.373, 8.050, -2.902 ], "form": "B", "ssZp": 1.867, "Dp": 1.811, "splay_angle": 22.050, "splay_distance": 3.601, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 160.723, "theta": -132.943, "eta_prime": -161.000, "theta_prime": -169.802, "eta_base": -114.065, "theta_base": -115.224, "v0": -11.350, "v1": 33.410, "v2": -41.552, "v3": 35.867, "v4": -15.682, "amplitude": 41.610, "phase_angle": 183.039, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 123.520, 109.524, 111.320 ], "x_axis": [ 0.932, 0.042, -0.359 ], "y_axis": [ 0.317, -0.577, 0.753 ], "z_axis": [ -0.175, -0.816, -0.551 ], "quaternion": [ 0.449, 0.875, 0.103, -0.153 ] } }, { "index": 116, "index_chain": 6, "chain_name": "G", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/6", "linked_nts": [ "///G/5", "///G/7" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.489, "beta": 176.387, "gamma": 39.165, "delta": 138.167, "epsilon": -176.752, "zeta": -94.847, "epsilon_zeta": -81.906, "bb_type": "BI", "chi": -99.917, "glyco_bond": "anti", "C5prime_xyz": [ -1.917, 7.960, -2.210 ], "P_xyz": [ 0.465, 8.978, -2.148 ], "form": "B", "ssZp": 1.814, "Dp": 2.062, "splay_angle": 20.011, "splay_distance": 3.384, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 165.694, "theta": -134.733, "eta_prime": -165.029, "theta_prime": -148.176, "eta_base": -109.019, "theta_base": -105.265, "v0": -14.742, "v1": 27.242, "v2": -28.866, "v3": 21.041, "v4": -4.259, "amplitude": 29.371, "phase_angle": 169.364, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.011, "origin": [ 123.617, 106.282, 109.754 ], "x_axis": [ 0.886, -0.386, 0.256 ], "y_axis": [ -0.432, -0.489, 0.758 ], "z_axis": [ -0.167, -0.782, -0.600 ], "quaternion": [ 0.446, 0.862, -0.237, 0.026 ] } }, { "index": 117, "index_chain": 7, "chain_name": "G", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/7", "linked_nts": [ "///G/6", "///G/8" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -63.049, "beta": 173.491, "gamma": 53.926, "delta": 133.705, "epsilon": -172.879, "zeta": -114.101, "epsilon_zeta": -58.777, "bb_type": "BI", "chi": -102.027, "glyco_bond": "anti", "C5prime_xyz": [ -2.668, 8.081, -2.202 ], "P_xyz": [ -0.450, 9.321, -2.728 ], "form": "B", "ssZp": 2.194, "Dp": 2.273, "splay_angle": 20.456, "splay_distance": 3.548, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 165.773, "theta": -149.740, "eta_prime": -163.678, "theta_prime": -166.037, "eta_base": -116.201, "theta_base": -122.846, "v0": -30.809, "v1": 38.777, "v2": -31.750, "v3": 14.917, "v4": 9.637, "amplitude": 38.008, "phase_angle": 146.651, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 123.654, 103.129, 108.527 ], "x_axis": [ 0.493, -0.549, 0.675 ], "y_axis": [ -0.870, -0.294, 0.396 ], "z_axis": [ -0.019, -0.782, -0.623 ], "quaternion": [ 0.379, 0.776, -0.457, 0.211 ] } }, { "index": 118, "index_chain": 8, "chain_name": "G", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/8", "linked_nts": [ "///G/7", "///G/9" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.751, "beta": 156.522, "gamma": 56.845, "delta": 121.292, "epsilon": -168.226, "zeta": -97.551, "epsilon_zeta": -70.675, "bb_type": "BI", "chi": -127.046, "glyco_bond": "anti", "C5prime_xyz": [ -2.806, 8.648, -1.303 ], "P_xyz": [ -0.609, 10.023, -1.499 ], "form": ".", "ssZp": 2.565, "Dp": 2.529, "splay_angle": 22.453, "splay_distance": 3.897, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 175.445, "theta": -143.738, "eta_prime": -163.934, "theta_prime": -155.187, "eta_base": -115.580, "theta_base": -106.566, "v0": -39.504, "v1": 39.531, "v2": -24.819, "v3": 2.816, "v4": 22.764, "amplitude": 40.624, "phase_angle": 127.658, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 124.360, 100.026, 106.957 ], "x_axis": [ -0.074, -0.627, 0.776 ], "y_axis": [ -0.997, 0.037, -0.066 ], "z_axis": [ 0.012, -0.779, -0.627 ], "quaternion": [ -0.290, -0.616, 0.659, -0.320 ] } }, { "index": 119, "index_chain": 9, "chain_name": "G", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/9", "linked_nts": [ "///G/8", "///G/10" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.882, "beta": 163.236, "gamma": 74.290, "delta": 110.362, "epsilon": -168.368, "zeta": -93.356, "epsilon_zeta": -75.012, "bb_type": "BI", "chi": -137.926, "glyco_bond": "anti", "C5prime_xyz": [ -2.694, 8.790, -1.019 ], "P_xyz": [ -0.486, 10.108, -1.284 ], "form": "B", "ssZp": 2.573, "Dp": 2.641, "splay_angle": 18.047, "splay_distance": 3.109, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 175.735, "theta": -152.068, "eta_prime": -162.294, "theta_prime": -156.986, "eta_base": -106.080, "theta_base": -129.594, "v0": -40.776, "v1": 33.230, "v2": -14.189, "v3": -8.568, "v4": 30.832, "amplitude": 39.485, "phase_angle": 111.061, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 124.456, 96.254, 105.986 ], "x_axis": [ -0.707, -0.465, 0.532 ], "y_axis": [ -0.705, 0.413, -0.576 ], "z_axis": [ 0.048, -0.783, -0.621 ], "quaternion": [ -0.146, -0.354, 0.828, -0.410 ] } }, { "index": 120, "index_chain": 10, "chain_name": "G", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/10", "linked_nts": [ "///G/9", "///G/11" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -68.778, "beta": 176.203, "gamma": 56.299, "delta": 139.375, "epsilon": -139.101, "zeta": -142.348, "epsilon_zeta": 3.247, "bb_type": "--", "chi": -106.276, "glyco_bond": "anti", "C5prime_xyz": [ -2.870, 8.241, -1.929 ], "P_xyz": [ -0.781, 9.793, -2.053 ], "form": "B", "ssZp": 1.671, "Dp": 1.774, "splay_angle": 20.374, "splay_distance": 3.384, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 175.377, "theta": -156.624, "eta_prime": -160.321, "theta_prime": -163.584, "eta_base": -130.270, "theta_base": -112.543, "v0": -31.062, "v1": 42.054, "v2": -36.650, "v3": 20.060, "v4": 6.432, "amplitude": 41.435, "phase_angle": 152.193, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 125.140, 93.473, 104.775 ], "x_axis": [ -0.965, -0.169, 0.199 ], "y_axis": [ -0.255, 0.452, -0.855 ], "z_axis": [ 0.054, -0.876, -0.480 ], "quaternion": [ -0.042, -0.124, 0.851, -0.508 ] } }, { "index": 121, "index_chain": 11, "chain_name": "G", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/11", "linked_nts": [ "///G/10", "///G/12" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.336, "beta": 144.994, "gamma": 49.400, "delta": 135.636, "epsilon": -158.948, "zeta": -88.958, "epsilon_zeta": -69.990, "bb_type": "BI", "chi": -102.947, "glyco_bond": "anti", "C5prime_xyz": [ -2.855, 8.135, -2.100 ], "P_xyz": [ -0.469, 9.084, -2.535 ], "form": "B", "ssZp": 2.056, "Dp": 2.109, "splay_angle": 18.791, "splay_distance": 3.195, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 167.480, "theta": -139.780, "eta_prime": -165.266, "theta_prime": -168.111, "eta_base": -113.468, "theta_base": -130.338, "v0": -31.656, "v1": 41.152, "v2": -34.755, "v3": 17.635, "v4": 8.316, "amplitude": 40.416, "phase_angle": 149.309, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 124.930, 90.739, 102.791 ], "x_axis": [ -0.893, 0.076, -0.444 ], "y_axis": [ 0.439, 0.365, -0.821 ], "z_axis": [ 0.099, -0.928, -0.359 ], "quaternion": [ 0.168, 0.159, 0.809, -0.541 ] } }, { "index": 122, "index_chain": 12, "chain_name": "G", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/12", "linked_nts": [ "///G/11", "///G/13" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -119.265, "beta": 90.214, "gamma": 152.738, "delta": 155.285, "epsilon": -137.176, "zeta": -90.443, "epsilon_zeta": -46.732, "bb_type": "BI", "chi": -140.495, "glyco_bond": "anti", "C5prime_xyz": [ -1.932, 8.651, 0.102 ], "P_xyz": [ -0.779, 9.650, -2.038 ], "form": "B", "ssZp": 1.002, "Dp": 1.569, "splay_angle": 19.355, "splay_distance": 3.186, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -117.201, "theta": 172.764, "eta_prime": -145.484, "theta_prime": -156.476, "eta_base": -111.626, "theta_base": -103.396, "v0": -21.253, "v1": 40.676, "v2": -43.402, "v3": 32.291, "v4": -7.209, "amplitude": 44.009, "phase_angle": 170.468, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 124.850, 87.680, 101.873 ], "x_axis": [ -0.531, 0.230, -0.815 ], "y_axis": [ 0.847, 0.179, -0.501 ], "z_axis": [ 0.031, -0.957, -0.290 ], "quaternion": [ 0.299, 0.381, 0.707, -0.515 ] } }, { "index": 123, "index_chain": 13, "chain_name": "G", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/13", "linked_nts": [ "///G/12", null ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -44.631, "beta": -171.404, "gamma": -9.778, "delta": 153.321, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -73.456, "glyco_bond": "--", "C5prime_xyz": [ -2.206, 6.933, -2.917 ], "P_xyz": [ -0.490, 8.685, -3.875 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -5.480, "v1": 25.762, "v2": -35.121, "v3": 32.768, "v4": -17.430, "amplitude": 35.657, "phase_angle": 189.947, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 125.176, 84.878, 100.391 ], "x_axis": [ 0.217, 0.261, -0.941 ], "y_axis": [ 0.962, -0.222, 0.161 ], "z_axis": [ -0.167, -0.940, -0.299 ], "quaternion": [ 0.417, 0.659, 0.464, -0.420 ] } } ], "num_hbonds": 1216, "hbonds": [ { "index": 1, "atom1_serNum": 9, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/2/N", "atom2_id": "///A/76/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 623, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///A/2/O", "atom2_id": "///A/76/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 29, "atom2_serNum": 50, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/4/O", "atom2_id": "///A/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 32, "atom2_serNum": 623, "donAcc_type": "standard", "distance": 3.740, "atom1_id": "///A/4/OD1", "atom2_id": "///A/76/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 33, "atom2_serNum": 662, "donAcc_type": "acceptable", "distance": 2.522, "atom1_id": "///A/4/ND2", "atom2_id": "///A/80/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 37, "atom2_serNum": 67, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 45, "atom2_serNum": 76, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 49, "atom2_serNum": 662, "donAcc_type": "acceptable", "distance": 3.365, "atom1_id": "///A/6/OD2", "atom2_id": "///A/80/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 53, "atom2_serNum": 84, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 61, "atom2_serNum": 92, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 70, "atom2_serNum": 100, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 79, "atom2_serNum": 109, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 87, "atom2_serNum": 121, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 95, "atom2_serNum": 129, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 103, "atom2_serNum": 134, "donAcc_type": "acceptable", "distance": 3.047, "atom1_id": "///A/13/O", "atom2_id": "///A/16/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 103, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 112, "atom2_serNum": 146, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 120, "atom2_serNum": 801, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///A/14/OH", "atom2_id": "///A/96/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 124, "atom2_serNum": 158, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 138, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///A/17/O", "atom2_id": "///A/155/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 144, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/17/NH1", "atom2_id": "///A/96/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 145, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/17/NH2", "atom2_id": "///A/96/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 177, "atom2_serNum": 8285, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/20/NZ", "atom2_id": "///C/954/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 192, "atom2_serNum": 225, "donAcc_type": "standard", "distance": 3.739, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 196, "atom2_serNum": 372, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/22/OE1", "atom2_id": "///A/42/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 197, "atom2_serNum": 372, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/22/OE2", "atom2_id": "///A/42/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 198, "atom2_serNum": 204, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/23/N", "atom2_id": "///A/23/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 204, "atom2_serNum": 206, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/23/OD1", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 209, "atom2_serNum": 237, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///A/24/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 228, "atom2_serNum": 282, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/26/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 236, "atom2_serNum": 306, "donAcc_type": "acceptable", "distance": 2.450, "atom1_id": "///A/26/OH", "atom2_id": "///A/35/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 249, "atom2_serNum": 261, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/28/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 249, "atom2_serNum": 265, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/28/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 249, "atom2_serNum": 273, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 268, "atom2_serNum": 459, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/31/O", "atom2_id": "///A/55/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 268, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/31/O", "atom2_id": "///A/55/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 296, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 298, "atom2_serNum": 320, "donAcc_type": "acceptable", "distance": 3.105, "atom1_id": "///A/34/OG1", "atom2_id": "///A/37/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 303, "atom2_serNum": 335, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 311, "atom2_serNum": 344, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 316, "atom2_serNum": 353, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 324, "atom2_serNum": 364, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 338, "atom2_serNum": 380, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/39/O", "atom2_id": "///A/43/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 347, "atom2_serNum": 385, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/40/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 347, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/40/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 356, "atom2_serNum": 381, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///A/41/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 399, "atom2_serNum": 412, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/47/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 415, "atom2_serNum": 1954, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///A/49/O", "atom2_id": "///B/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 433, "atom2_serNum": 1940, "donAcc_type": "questionable", "distance": 2.964, "atom1_id": "///A/51/O", "atom2_id": "///B/51/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 441, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 445, "atom2_serNum": 470, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 447, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/54/N", "atom2_id": "///B/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 450, "atom2_serNum": 478, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 455, "atom2_serNum": 483, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 466, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 473, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 477, "atom2_serNum": 1511, "donAcc_type": "standard", "distance": 3.774, "atom1_id": "///A/57/ND2", "atom2_id": "///B/1/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 481, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 486, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 494, "atom2_serNum": 521, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 502, "atom2_serNum": 524, "donAcc_type": "questionable", "distance": 2.998, "atom1_id": "///A/61/O", "atom2_id": "///A/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 510, "atom2_serNum": 1248, "donAcc_type": "standard", "distance": 3.615, "atom1_id": "///A/62/O", "atom2_id": "///A/153/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 532, "atom2_serNum": 566, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/65/N", "atom2_id": "///A/68/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 535, "atom2_serNum": 568, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 538, "atom2_serNum": 540, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/65/OD1", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 543, "atom2_serNum": 576, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 551, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 562, "atom2_serNum": 589, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 562, "atom2_serNum": 794, "donAcc_type": "acceptable", "distance": 3.466, "atom1_id": "///A/68/O", "atom2_id": "///A/95/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 567, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 2.339, "atom1_id": "///A/68/OE2", "atom2_id": "///A/99/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 571, "atom2_serNum": 597, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 579, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 584, "atom2_serNum": 610, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 592, "atom2_serNum": 615, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 600, "atom2_serNum": 624, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 601, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/74/N", "atom2_id": "///B/66/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 604, "atom2_serNum": 631, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 613, "atom2_serNum": 639, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 618, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 638, "atom2_serNum": 782, "donAcc_type": "acceptable", "distance": 2.452, "atom1_id": "///A/78/ND2", "atom2_id": "///A/94/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 650, "atom2_serNum": 729, "donAcc_type": "acceptable", "distance": 3.199, "atom1_id": "///A/79/OH", "atom2_id": "///A/89/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 674, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/82/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 674, "atom2_serNum": 693, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/82/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 682, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 690, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 696, "atom2_serNum": 729, "donAcc_type": "questionable", "distance": 3.309, "atom1_id": "///A/85/O", "atom2_id": "///A/89/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 737, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/90/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 737, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 3.466, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 744, "atom2_serNum": 783, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 755, "atom2_serNum": 795, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 767, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 774, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 786, "atom2_serNum": 822, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 798, "atom2_serNum": 831, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 806, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 814, "atom2_serNum": 849, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 825, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 830, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/99/NZ", "atom2_id": "///A/153/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 834, "atom2_serNum": 866, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 839, "atom2_serNum": 1465, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///A/100/NZ", "atom2_id": "///A/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 843, "atom2_serNum": 874, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 852, "atom2_serNum": 883, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 861, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 869, "atom2_serNum": 905, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 877, "atom2_serNum": 914, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 886, "atom2_serNum": 928, "donAcc_type": "questionable", "distance": 2.893, "atom1_id": "///A/106/O", "atom2_id": "///A/110/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 937, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/111/NE", "atom2_id": "///A/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 939, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///A/111/NH1", "atom2_id": "///A/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 944, "atom2_serNum": 1369, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/112/O", "atom2_id": "///A/168/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 952, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/113/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 952, "atom2_serNum": 1139, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/113/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 964, "atom2_serNum": 1129, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/115/N", "atom2_id": "///A/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 967, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/115/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 976, "atom2_serNum": 1113, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/117/N", "atom2_id": "///A/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 979, "atom2_serNum": 1110, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/117/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 980, "atom2_serNum": 10714, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/118/N", "atom2_id": "///D/71/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 117, "atom1_serNum": 985, "atom2_serNum": 10715, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///A/118/OG1", "atom2_id": "///D/71/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 118, "atom1_serNum": 987, "atom2_serNum": 1093, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/119/N", "atom2_id": "///A/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 990, "atom2_serNum": 1085, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/119/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 990, "atom2_serNum": 1090, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/119/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 994, "atom2_serNum": 8688, "donAcc_type": "standard", "distance": 2.406, "atom1_id": "///A/120/O", "atom2_id": "///C/1003/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 998, "atom2_serNum": 8574, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/120/NE", "atom2_id": "///C/989/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1000, "atom2_serNum": 8554, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/120/NH1", "atom2_id": "///C/987/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1000, "atom2_serNum": 8574, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/120/NH1", "atom2_id": "///C/989/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1001, "atom2_serNum": 8549, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///A/120/NH2", "atom2_id": "///C/986/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1002, "atom2_serNum": 1067, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/121/N", "atom2_id": "///A/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1005, "atom2_serNum": 1064, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/121/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1022, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/123/N", "atom2_id": "///A/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1025, "atom2_serNum": 1040, "donAcc_type": "standard", "distance": 3.913, "atom1_id": "///A/123/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1043, "atom2_serNum": 8751, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/126/O", "atom2_id": "///C/1010/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1050, "atom2_serNum": 8209, "donAcc_type": "questionable", "distance": 2.911, "atom1_id": "///A/127/OD1", "atom2_id": "///C/944/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1050, "atom2_serNum": 8211, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/127/OD1", "atom2_id": "///C/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1051, "atom2_serNum": 8202, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/127/ND2", "atom2_id": "///C/943/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1055, "atom2_serNum": 8229, "donAcc_type": "standard", "distance": 3.663, "atom1_id": "///A/128/O", "atom2_id": "///C/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1063, "atom2_serNum": 8549, "donAcc_type": "acceptable", "distance": 3.126, "atom1_id": "///A/128/OH", "atom2_id": "///C/986/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1063, "atom2_serNum": 10678, "donAcc_type": "acceptable", "distance": 3.715, "atom1_id": "///A/128/OH", "atom2_id": "///D/69/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 137, "atom1_serNum": 1072, "atom2_serNum": 8232, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/130/N", "atom2_id": "///C/947/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1088, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 3.777, "atom1_id": "///A/132/O", "atom2_id": "///A/155/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1101, "atom2_serNum": 8688, "donAcc_type": "acceptable", "distance": 3.765, "atom1_id": "///A/133/OH", "atom2_id": "///C/1003/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1102, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/134/N", "atom2_id": "///A/154/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1105, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/134/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1117, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/135/OE1", "atom2_id": "///A/151/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1117, "atom2_serNum": 8604, "donAcc_type": "standard", "distance": 2.407, "atom1_id": "///A/135/OE1", "atom2_id": "///C/992/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1119, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/136/N", "atom2_id": "///A/152/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1122, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/136/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1131, "atom2_serNum": 1217, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///A/138/N", "atom2_id": "///A/150/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1142, "atom2_serNum": 1165, "donAcc_type": "acceptable", "distance": 3.156, "atom1_id": "///A/139/O", "atom2_id": "///A/142/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1146, "atom2_serNum": 1368, "donAcc_type": "standard", "distance": 2.496, "atom1_id": "///A/139/OE1", "atom2_id": "///A/168/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1157, "atom2_serNum": 1159, "donAcc_type": "acceptable", "distance": 2.676, "atom1_id": "///A/141/O", "atom2_id": "///A/141/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1157, "atom2_serNum": 1206, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/141/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1159, "atom2_serNum": 1214, "donAcc_type": "acceptable", "distance": 3.601, "atom1_id": "///A/141/OG", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1166, "atom2_serNum": 1191, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/143/N", "atom2_id": "///A/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1169, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 3.935, "atom1_id": "///A/143/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1177, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.747, "atom1_id": "///A/144/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1193, "atom2_serNum": 8679, "donAcc_type": "acceptable", "distance": 2.791, "atom1_id": "///A/147/OG", "atom2_id": "///C/1002/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1197, "atom2_serNum": 2116, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/148/O", "atom2_id": "///B/74/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1261, "atom2_serNum": 1506, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///A/155/N", "atom2_id": "///A/183/OXT", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1264, "atom2_serNum": 1495, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/155/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1270, "atom2_serNum": 1277, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/156/N", "atom2_id": "///A/156/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1278, "atom2_serNum": 1482, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/157/N", "atom2_id": "///A/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1295, "atom2_serNum": 8267, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///A/158/OG", "atom2_id": "///C/951/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1308, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/160/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1308, "atom2_serNum": 8267, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/160/O", "atom2_id": "///C/951/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1317, "atom2_serNum": 10569, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/161/NE2", "atom2_id": "///D/64/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 165, "atom1_serNum": 1352, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 3.611, "atom1_id": "///A/166/O", "atom2_id": "///A/170/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1354, "atom2_serNum": 1397, "donAcc_type": "acceptable", "distance": 3.992, "atom1_id": "///A/166/OG", "atom2_id": "///A/171/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1354, "atom2_serNum": 10727, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///A/166/OG", "atom2_id": "///D/71/N7", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 168, "atom1_serNum": 1355, "atom2_serNum": 10738, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/167/N", "atom2_id": "///D/72/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 169, "atom1_serNum": 1358, "atom2_serNum": 1387, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1359, "atom2_serNum": 10758, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/168/N", "atom2_id": "///D/73/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 171, "atom1_serNum": 1362, "atom2_serNum": 1398, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1373, "atom2_serNum": 1406, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1382, "atom2_serNum": 1415, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/170/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1390, "atom2_serNum": 1429, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1397, "atom2_serNum": 10738, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/171/NH2", "atom2_id": "///D/72/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 176, "atom1_serNum": 1401, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1414, "atom2_serNum": 1452, "donAcc_type": "questionable", "distance": 3.178, "atom1_id": "///A/173/OE2", "atom2_id": "///A/177/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1418, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1423, "atom2_serNum": 1460, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/174/NE1", "atom2_id": "///A/178/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1516, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///B/2/N", "atom2_id": "///B/76/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1519, "atom2_serNum": 2130, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/2/O", "atom2_id": "///B/76/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1524, "atom2_serNum": 8785, "donAcc_type": "acceptable", "distance": 3.091, "atom1_id": "///B/2/NZ", "atom2_id": "///C/1015/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1533, "atom2_serNum": 1539, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///B/4/N", "atom2_id": "///B/4/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1536, "atom2_serNum": 1557, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/4/O", "atom2_id": "///B/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1544, "atom2_serNum": 1574, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/5/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1552, "atom2_serNum": 1583, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/6/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1556, "atom2_serNum": 2169, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///B/6/OD2", "atom2_id": "///B/80/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1560, "atom2_serNum": 1591, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1568, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/8/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1577, "atom2_serNum": 1607, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/9/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1586, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/10/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1594, "atom2_serNum": 1628, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/11/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1602, "atom2_serNum": 1636, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/12/O", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1610, "atom2_serNum": 1641, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///B/13/O", "atom2_id": "///B/16/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1610, "atom2_serNum": 1642, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/13/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1619, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/14/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1627, "atom2_serNum": 2308, "donAcc_type": "acceptable", "distance": 2.881, "atom1_id": "///B/14/OH", "atom2_id": "///B/96/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1627, "atom2_serNum": 2337, "donAcc_type": "acceptable", "distance": 3.861, "atom1_id": "///B/14/OH", "atom2_id": "///B/99/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1631, "atom2_serNum": 1665, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///B/15/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1645, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.756, "atom1_id": "///B/17/O", "atom2_id": "///B/155/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1652, "atom2_serNum": 2309, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///B/17/NH2", "atom2_id": "///B/96/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1699, "atom2_serNum": 1721, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/22/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1699, "atom2_serNum": 1732, "donAcc_type": "standard", "distance": 3.833, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1704, "atom2_serNum": 1879, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///B/22/OE2", "atom2_id": "///B/42/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1705, "atom2_serNum": 1711, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///B/23/N", "atom2_id": "///B/23/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1708, "atom2_serNum": 1744, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1711, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/23/OD1", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1724, "atom2_serNum": 1753, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/25/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1735, "atom2_serNum": 1780, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/26/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1735, "atom2_serNum": 1789, "donAcc_type": "standard", "distance": 3.404, "atom1_id": "///B/26/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1756, "atom2_serNum": 1768, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/28/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1756, "atom2_serNum": 1772, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/28/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1756, "atom2_serNum": 1780, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1775, "atom2_serNum": 1966, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/31/O", "atom2_id": "///B/55/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1803, "atom2_serNum": 1828, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1810, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1818, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1823, "atom2_serNum": 1860, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1826, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///B/37/OD1", "atom2_id": "///B/40/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1831, "atom2_serNum": 1871, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1845, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///B/39/O", "atom2_id": "///B/43/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1854, "atom2_serNum": 1892, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/40/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1863, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///B/41/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1903, "atom2_serNum": 1909, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///B/47/N", "atom2_id": "///B/47/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1906, "atom2_serNum": 1919, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/47/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1948, "atom2_serNum": 1970, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/52/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1952, "atom2_serNum": 1977, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/53/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1957, "atom2_serNum": 1985, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/54/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1962, "atom2_serNum": 1990, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/55/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1973, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1980, "atom2_serNum": 2006, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1988, "atom2_serNum": 2014, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2001, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2009, "atom2_serNum": 2031, "donAcc_type": "questionable", "distance": 2.977, "atom1_id": "///B/61/O", "atom2_id": "///B/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2017, "atom2_serNum": 2755, "donAcc_type": "standard", "distance": 3.699, "atom1_id": "///B/62/O", "atom2_id": "///B/153/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2039, "atom2_serNum": 2073, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/65/N", "atom2_id": "///B/68/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2042, "atom2_serNum": 2075, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2045, "atom2_serNum": 2047, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///B/65/OD1", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2046, "atom2_serNum": 2736, "donAcc_type": "questionable", "distance": 2.842, "atom1_id": "///B/65/OD2", "atom2_id": "///B/151/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2050, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2058, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2069, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2069, "atom2_serNum": 2301, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///B/68/O", "atom2_id": "///B/95/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2074, "atom2_serNum": 2337, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///B/68/OE2", "atom2_id": "///B/99/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2078, "atom2_serNum": 2104, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2086, "atom2_serNum": 2108, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2091, "atom2_serNum": 2117, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2099, "atom2_serNum": 2122, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2107, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2111, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2116, "atom2_serNum": 8679, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///B/74/NZ", "atom2_id": "///C/1002/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2120, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2125, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2145, "atom2_serNum": 8669, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///B/78/ND2", "atom2_id": "///C/1001/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2157, "atom2_serNum": 2236, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/79/OH", "atom2_id": "///B/89/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2161, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///B/80/O", "atom2_id": "///B/86/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2176, "atom2_serNum": 8733, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///B/81/OD1", "atom2_id": "///C/1008/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2177, "atom2_serNum": 8670, "donAcc_type": "questionable", "distance": 3.063, "atom1_id": "///B/81/ND2", "atom2_id": "///C/1001/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2181, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/82/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2181, "atom2_serNum": 2200, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/82/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2185, "atom2_serNum": 2199, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///B/82/OD2", "atom2_id": "///B/84/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2186, "atom2_serNum": 9590, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/83/N", "atom2_id": "///C/1115/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2193, "atom2_serNum": 8809, "donAcc_type": "questionable", "distance": 3.145, "atom1_id": "///B/83/ND2", "atom2_id": "///C/1019/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2197, "atom2_serNum": 2225, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2203, "atom2_serNum": 2233, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2244, "atom2_serNum": 2271, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///B/90/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2251, "atom2_serNum": 2278, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/91/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2251, "atom2_serNum": 2290, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2262, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2274, "atom2_serNum": 2310, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/93/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2281, "atom2_serNum": 2318, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2293, "atom2_serNum": 2329, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/95/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2305, "atom2_serNum": 2338, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/96/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2313, "atom2_serNum": 2347, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2321, "atom2_serNum": 2356, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/98/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2332, "atom2_serNum": 2365, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/99/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2337, "atom2_serNum": 2749, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/99/NZ", "atom2_id": "///B/153/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2341, "atom2_serNum": 2373, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/100/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2346, "atom2_serNum": 2972, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///B/100/NZ", "atom2_id": "///B/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2350, "atom2_serNum": 2381, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/101/O", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2359, "atom2_serNum": 2390, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/102/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2368, "atom2_serNum": 2404, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/103/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2376, "atom2_serNum": 2412, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/104/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2384, "atom2_serNum": 2421, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/105/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2393, "atom2_serNum": 2435, "donAcc_type": "questionable", "distance": 2.832, "atom1_id": "///B/106/O", "atom2_id": "///B/110/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2429, "atom2_serNum": 2435, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///B/110/N", "atom2_id": "///B/110/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2444, "atom2_serNum": 2952, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/111/NE", "atom2_id": "///B/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2446, "atom2_serNum": 2952, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///B/111/NH1", "atom2_id": "///B/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2451, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///B/112/O", "atom2_id": "///B/168/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2459, "atom2_serNum": 2471, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///B/113/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2459, "atom2_serNum": 2646, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/113/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2471, "atom2_serNum": 2636, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/115/N", "atom2_id": "///B/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2474, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/115/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2483, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/117/N", "atom2_id": "///B/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2486, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/117/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2494, "atom2_serNum": 2600, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/119/N", "atom2_id": "///B/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2497, "atom2_serNum": 2592, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/119/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2497, "atom2_serNum": 2597, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/119/O", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2509, "atom2_serNum": 2574, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///B/121/N", "atom2_id": "///B/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2512, "atom2_serNum": 2571, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///B/121/O", "atom2_id": "///B/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2529, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/123/N", "atom2_id": "///B/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2534, "atom2_serNum": 2554, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///B/123/OG1", "atom2_id": "///B/127/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2595, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.976, "atom1_id": "///B/132/O", "atom2_id": "///B/155/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2609, "atom2_serNum": 2760, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/134/N", "atom2_id": "///B/154/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2612, "atom2_serNum": 2757, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/134/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2624, "atom2_serNum": 2737, "donAcc_type": "standard", "distance": 2.341, "atom1_id": "///B/135/OE1", "atom2_id": "///B/151/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2626, "atom2_serNum": 2741, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/136/N", "atom2_id": "///B/152/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2629, "atom2_serNum": 2738, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/136/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2638, "atom2_serNum": 2724, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///B/138/N", "atom2_id": "///B/150/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2649, "atom2_serNum": 2672, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///B/139/O", "atom2_id": "///B/142/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2653, "atom2_serNum": 2875, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/139/OE1", "atom2_id": "///B/168/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2653, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/139/OE1", "atom2_id": "///B/168/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2664, "atom2_serNum": 2666, "donAcc_type": "acceptable", "distance": 2.562, "atom1_id": "///B/141/O", "atom2_id": "///B/141/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2664, "atom2_serNum": 2713, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/141/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2666, "atom2_serNum": 2721, "donAcc_type": "acceptable", "distance": 3.841, "atom1_id": "///B/141/OG", "atom2_id": "///B/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2673, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 3.767, "atom1_id": "///B/143/N", "atom2_id": "///B/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2676, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/143/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2688, "atom2_serNum": 2690, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///B/145/O", "atom2_id": "///B/145/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2704, "atom2_serNum": 2736, "donAcc_type": "questionable", "distance": 3.261, "atom1_id": "///B/148/O", "atom2_id": "///B/151/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2771, "atom2_serNum": 3002, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///B/155/O", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2777, "atom2_serNum": 2784, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/156/N", "atom2_id": "///B/156/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2783, "atom2_serNum": 2802, "donAcc_type": "acceptable", "distance": 3.373, "atom1_id": "///B/156/OD1", "atom2_id": "///B/158/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2785, "atom2_serNum": 2989, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///B/157/N", "atom2_id": "///B/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2852, "atom2_serNum": 2901, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///B/165/O", "atom2_id": "///B/171/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2869, "atom2_serNum": 2905, "donAcc_type": "standard", "distance": 3.494, "atom1_id": "///B/168/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2880, "atom2_serNum": 2913, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/169/O", "atom2_id": "///B/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2889, "atom2_serNum": 2922, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/170/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2897, "atom2_serNum": 2936, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/171/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2916, "atom2_serNum": 2953, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2920, "atom2_serNum": 2960, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///B/173/OE1", "atom2_id": "///B/177/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2921, "atom2_serNum": 2959, "donAcc_type": "questionable", "distance": 2.805, "atom1_id": "///B/173/OE2", "atom2_id": "///B/177/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2925, "atom2_serNum": 2961, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/174/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2930, "atom2_serNum": 2967, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/174/NE1", "atom2_id": "///B/178/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2956, "atom2_serNum": 2969, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/177/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3018, "atom2_serNum": 3137, "donAcc_type": "questionable", "distance": 2.901, "atom1_id": "///C/3/O", "atom2_id": "///C/21/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3026, "atom2_serNum": 6938, "donAcc_type": "standard", "distance": 3.572, "atom1_id": "///C/4/O", "atom2_id": "///C/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3031, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/5/N", "atom2_id": "///C/20/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3034, "atom2_serNum": 3126, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/5/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3038, "atom2_serNum": 6941, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/6/N", "atom2_id": "///C/505/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3041, "atom2_serNum": 6954, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/6/O", "atom2_id": "///C/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3046, "atom2_serNum": 3117, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/7/N", "atom2_id": "///C/18/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3049, "atom2_serNum": 3114, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/7/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3050, "atom2_serNum": 6957, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///C/8/N", "atom2_id": "///C/507/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3053, "atom2_serNum": 6969, "donAcc_type": "standard", "distance": 3.532, "atom1_id": "///C/8/O", "atom2_id": "///C/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3058, "atom2_serNum": 3106, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/9/N", "atom2_id": "///C/16/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3061, "atom2_serNum": 3103, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/9/O", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3074, "atom2_serNum": 3093, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/11/N", "atom2_id": "///C/14/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3077, "atom2_serNum": 6786, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///C/11/O", "atom2_id": "///C/485/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3089, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///C/13/O", "atom2_id": "///C/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3089, "atom2_serNum": 3249, "donAcc_type": "questionable", "distance": 2.810, "atom1_id": "///C/13/O", "atom2_id": "///C/35/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3095, "atom2_serNum": 3230, "donAcc_type": "acceptable", "distance": 3.170, "atom1_id": "///C/14/OG", "atom2_id": "///C/33/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3096, "atom2_serNum": 3230, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/15/N", "atom2_id": "///C/33/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3099, "atom2_serNum": 3226, "donAcc_type": "acceptable", "distance": 3.861, "atom1_id": "///C/15/O", "atom2_id": "///C/32/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3099, "atom2_serNum": 3227, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/15/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3107, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/17/N", "atom2_id": "///C/31/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3110, "atom2_serNum": 3213, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/17/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3118, "atom2_serNum": 3197, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/19/N", "atom2_id": "///C/29/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3121, "atom2_serNum": 3186, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///C/19/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3134, "atom2_serNum": 3172, "donAcc_type": "standard", "distance": 3.801, "atom1_id": "///C/21/N", "atom2_id": "///C/26/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3141, "atom2_serNum": 3176, "donAcc_type": "standard", "distance": 3.914, "atom1_id": "///C/21/ND2", "atom2_id": "///C/26/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3203, "atom2_serNum": 9505, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///C/29/NE2", "atom2_id": "///C/1104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3207, "atom2_serNum": 7207, "donAcc_type": "standard", "distance": 3.729, "atom1_id": "///C/30/O", "atom2_id": "///C/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3213, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/31/N", "atom2_id": "///C/31/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3220, "atom2_serNum": 9498, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///C/31/ND2", "atom2_id": "///C/1103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3221, "atom2_serNum": 7210, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///C/32/N", "atom2_id": "///C/809/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3224, "atom2_serNum": 7226, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///C/32/O", "atom2_id": "///C/811/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3234, "atom2_serNum": 6812, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///C/33/NE", "atom2_id": "///C/488/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3236, "atom2_serNum": 7231, "donAcc_type": "acceptable", "distance": 3.618, "atom1_id": "///C/33/NH1", "atom2_id": "///C/811/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3238, "atom2_serNum": 7229, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///C/34/N", "atom2_id": "///C/811/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3241, "atom2_serNum": 7244, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///C/34/O", "atom2_id": "///C/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3260, "atom2_serNum": 3269, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///C/36/O", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3260, "atom2_serNum": 6780, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///C/36/O", "atom2_id": "///C/484/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3267, "atom2_serNum": 3274, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///C/37/O", "atom2_id": "///C/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3267, "atom2_serNum": 3281, "donAcc_type": "questionable", "distance": 2.820, "atom1_id": "///C/37/O", "atom2_id": "///C/39/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3274, "atom2_serNum": 3281, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///C/39/N", "atom2_id": "///C/39/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3277, "atom2_serNum": 3304, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/39/O", "atom2_id": "///C/42/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3282, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/39/NE2", "atom2_id": "///C/41/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3300, "atom2_serNum": 3328, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/42/O", "atom2_id": "///C/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3308, "atom2_serNum": 3339, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/43/O", "atom2_id": "///C/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3316, "atom2_serNum": 3350, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3316, "atom2_serNum": 3355, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///C/44/O", "atom2_id": "///C/48/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3324, "atom2_serNum": 3357, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///C/45/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3331, "atom2_serNum": 3365, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3335, "atom2_serNum": 10945, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/46/NE", "atom2_id": "///D/82/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 385, "atom1_serNum": 3342, "atom2_serNum": 3376, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3346, "atom2_serNum": 9906, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/47/NE", "atom2_id": "///D/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 387, "atom1_serNum": 3349, "atom2_serNum": 9884, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///C/47/NH2", "atom2_id": "///D/13/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 388, "atom1_serNum": 3349, "atom2_serNum": 9906, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///C/47/NH2", "atom2_id": "///D/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 389, "atom1_serNum": 3353, "atom2_serNum": 3385, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3360, "atom2_serNum": 3389, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3375, "atom2_serNum": 9905, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///C/50/NH2", "atom2_id": "///D/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 392, "atom1_serNum": 3375, "atom2_serNum": 9928, "donAcc_type": "standard", "distance": 3.736, "atom1_id": "///C/50/NH2", "atom2_id": "///D/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 393, "atom1_serNum": 3384, "atom2_serNum": 9928, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///C/51/NE2", "atom2_id": "///D/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 394, "atom1_serNum": 3384, "atom2_serNum": 9940, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/51/NE2", "atom2_id": "///D/15/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 395, "atom1_serNum": 3388, "atom2_serNum": 3419, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///C/52/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3392, "atom2_serNum": 3426, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///C/53/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3398, "atom2_serNum": 10958, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///C/53/NH1", "atom2_id": "///D/82/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 398, "atom1_serNum": 3399, "atom2_serNum": 10946, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///C/53/NH2", "atom2_id": "///D/82/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 399, "atom1_serNum": 3403, "atom2_serNum": 3437, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/54/O", "atom2_id": "///C/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3407, "atom2_serNum": 10903, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///C/54/NE", "atom2_id": "///D/80/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 401, "atom1_serNum": 3409, "atom2_serNum": 9950, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///C/54/NH1", "atom2_id": "///D/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 402, "atom1_serNum": 3410, "atom2_serNum": 9927, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///C/54/NH2", "atom2_id": "///D/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 403, "atom1_serNum": 3410, "atom2_serNum": 10902, "donAcc_type": "standard", "distance": 3.986, "atom1_id": "///C/54/NH2", "atom2_id": "///D/80/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 404, "atom1_serNum": 3414, "atom2_serNum": 3448, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///C/55/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3422, "atom2_serNum": 3457, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/56/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3429, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3435, "atom2_serNum": 10903, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///C/57/NH1", "atom2_id": "///D/80/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 408, "atom1_serNum": 3436, "atom2_serNum": 10883, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///C/57/NH2", "atom2_id": "///D/79/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 409, "atom1_serNum": 3436, "atom2_serNum": 10903, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///C/57/NH2", "atom2_id": "///D/80/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 410, "atom1_serNum": 3440, "atom2_serNum": 3476, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/58/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3444, "atom2_serNum": 10859, "donAcc_type": "standard", "distance": 3.619, "atom1_id": "///C/58/NE", "atom2_id": "///D/78/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 412, "atom1_serNum": 3446, "atom2_serNum": 9949, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/58/NH1", "atom2_id": "///D/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 413, "atom1_serNum": 3447, "atom2_serNum": 9949, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/58/NH2", "atom2_id": "///D/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 414, "atom1_serNum": 3447, "atom2_serNum": 10882, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///C/58/NH2", "atom2_id": "///D/79/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 415, "atom1_serNum": 3451, "atom2_serNum": 3487, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3456, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 3.667, "atom1_id": "///C/59/NZ", "atom2_id": "///C/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3460, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3465, "atom2_serNum": 10628, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///C/60/NZ", "atom2_id": "///D/67/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 419, "atom1_serNum": 3469, "atom2_serNum": 3505, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3475, "atom2_serNum": 10826, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///C/61/NE2", "atom2_id": "///D/76/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 421, "atom1_serNum": 3479, "atom2_serNum": 3516, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/62/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3485, "atom2_serNum": 3901, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///C/62/NH1", "atom2_id": "///C/113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3490, "atom2_serNum": 3524, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3497, "atom2_serNum": 10606, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///C/63/NH2", "atom2_id": "///D/66/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 425, "atom1_serNum": 3501, "atom2_serNum": 3532, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3508, "atom2_serNum": 3543, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/65/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3519, "atom2_serNum": 3551, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3527, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3535, "atom2_serNum": 3571, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/68/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3541, "atom2_serNum": 10810, "donAcc_type": "standard", "distance": 3.739, "atom1_id": "///C/68/NH1", "atom2_id": "///D/75/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 431, "atom1_serNum": 3542, "atom2_serNum": 10806, "donAcc_type": "acceptable", "distance": 3.339, "atom1_id": "///C/68/NH2", "atom2_id": "///D/75/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 432, "atom1_serNum": 3542, "atom2_serNum": 10818, "donAcc_type": "standard", "distance": 3.840, "atom1_id": "///C/68/NH2", "atom2_id": "///D/76/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 433, "atom1_serNum": 3546, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///C/69/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3554, "atom2_serNum": 3590, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///C/70/O", "atom2_id": "///C/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3579, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///C/72/OE2", "atom2_id": "///C/214/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3593, "atom2_serNum": 3814, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///C/75/O", "atom2_id": "///C/102/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3613, "atom2_serNum": 3620, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///C/78/N", "atom2_id": "///C/78/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3661, "atom2_serNum": 3670, "donAcc_type": "acceptable", "distance": 3.503, "atom1_id": "///C/83/OG", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3665, "atom2_serNum": 10547, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///C/84/O", "atom2_id": "///D/63/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 440, "atom1_serNum": 3676, "atom2_serNum": 10170, "donAcc_type": "questionable", "distance": 3.171, "atom1_id": "///C/85/OD1", "atom2_id": "///D/26/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 441, "atom1_serNum": 3677, "atom2_serNum": 10166, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///C/85/ND2", "atom2_id": "///D/26/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 442, "atom1_serNum": 3697, "atom2_serNum": 3730, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/88/O", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3704, "atom2_serNum": 3741, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///C/89/O", "atom2_id": "///C/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3712, "atom2_serNum": 10538, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///C/89/OH", "atom2_id": "///D/63/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 445, "atom1_serNum": 3716, "atom2_serNum": 3748, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/90/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3725, "atom2_serNum": 3757, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/91/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3733, "atom2_serNum": 3761, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/92/O", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3737, "atom2_serNum": 4463, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///C/92/NE", "atom2_id": "///C/192/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3739, "atom2_serNum": 4151, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///C/92/NH1", "atom2_id": "///C/155/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3739, "atom2_serNum": 4462, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///C/92/NH1", "atom2_id": "///C/192/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3740, "atom2_serNum": 3888, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///C/92/NH2", "atom2_id": "///C/111/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3744, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///C/93/O", "atom2_id": "///C/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3751, "atom2_serNum": 3776, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///C/94/O", "atom2_id": "///C/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3756, "atom2_serNum": 3787, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///C/94/NZ", "atom2_id": "///C/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3760, "atom2_serNum": 4518, "donAcc_type": "acceptable", "distance": 2.975, "atom1_id": "///C/95/O", "atom2_id": "///C/199/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3760, "atom2_serNum": 4528, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///C/95/O", "atom2_id": "///C/200/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3779, "atom2_serNum": 4528, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/98/O", "atom2_id": "///C/200/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3793, "atom2_serNum": 4527, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/100/N", "atom2_id": "///C/200/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3804, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///C/101/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3810, "atom2_serNum": 3841, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/102/O", "atom2_id": "///C/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3813, "atom2_serNum": 4565, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///C/102/OD1", "atom2_id": "///C/204/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3818, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/103/O", "atom2_id": "///C/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3824, "atom2_serNum": 3831, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///C/104/N", "atom2_id": "///C/104/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3827, "atom2_serNum": 3860, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/104/O", "atom2_id": "///C/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3836, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/105/O", "atom2_id": "///C/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3844, "atom2_serNum": 3873, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/106/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3855, "atom2_serNum": 3882, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/107/O", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3863, "atom2_serNum": 3890, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/108/O", "atom2_id": "///C/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3868, "atom2_serNum": 3898, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/109/O", "atom2_id": "///C/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3868, "atom2_serNum": 4663, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///C/109/O", "atom2_id": "///C/215/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3876, "atom2_serNum": 3905, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///C/110/O", "atom2_id": "///C/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3881, "atom2_serNum": 10567, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///C/110/NZ", "atom2_id": "///D/64/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 473, "atom1_serNum": 3881, "atom2_serNum": 10582, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///C/110/NZ", "atom2_id": "///D/65/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 474, "atom1_serNum": 3913, "atom2_serNum": 10561, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///C/114/NZ", "atom2_id": "///D/64/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 475, "atom1_serNum": 3923, "atom2_serNum": 4251, "donAcc_type": "questionable", "distance": 3.122, "atom1_id": "///C/115/NE2", "atom2_id": "///C/166/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3923, "atom2_serNum": 10035, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/115/NE2", "atom2_id": "///D/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 477, "atom1_serNum": 3927, "atom2_serNum": 10014, "donAcc_type": "questionable", "distance": 2.912, "atom1_id": "///C/116/O", "atom2_id": "///D/19/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 478, "atom1_serNum": 3931, "atom2_serNum": 9992, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///C/116/NE", "atom2_id": "///D/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 479, "atom1_serNum": 3933, "atom2_serNum": 4692, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/116/NH1", "atom2_id": "///C/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3933, "atom2_serNum": 4707, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///C/116/NH1", "atom2_id": "///C/221/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3934, "atom2_serNum": 9979, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///C/116/NH2", "atom2_id": "///D/17/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 482, "atom1_serNum": 3938, "atom2_serNum": 4716, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///C/117/O", "atom2_id": "///C/222/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3939, "atom2_serNum": 4393, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///C/118/N", "atom2_id": "///C/184/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3942, "atom2_serNum": 4408, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///C/118/O", "atom2_id": "///C/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3952, "atom2_serNum": 4716, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///C/119/OG", "atom2_id": "///C/222/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3976, "atom2_serNum": 4002, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///C/133/O", "atom2_id": "///C/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3980, "atom2_serNum": 4011, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/134/O", "atom2_id": "///C/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3988, "atom2_serNum": 4019, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///C/135/O", "atom2_id": "///C/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4000, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/136/O", "atom2_id": "///C/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4005, "atom2_serNum": 4035, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/137/O", "atom2_id": "///C/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4014, "atom2_serNum": 4044, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/138/O", "atom2_id": "///C/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4022, "atom2_serNum": 4052, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/139/O", "atom2_id": "///C/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4029, "atom2_serNum": 4057, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///C/140/O", "atom2_id": "///C/143/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4029, "atom2_serNum": 4058, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/140/O", "atom2_id": "///C/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4038, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 3.674, "atom1_id": "///C/141/O", "atom2_id": "///C/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4051, "atom2_serNum": 4180, "donAcc_type": "questionable", "distance": 3.038, "atom1_id": "///C/142/ND2", "atom2_id": "///C/158/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4055, "atom2_serNum": 4076, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///C/143/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4061, "atom2_serNum": 4091, "donAcc_type": "questionable", "distance": 2.861, "atom1_id": "///C/144/O", "atom2_id": "///C/147/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4070, "atom2_serNum": 4100, "donAcc_type": "standard", "distance": 3.977, "atom1_id": "///C/145/O", "atom2_id": "///C/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4079, "atom2_serNum": 4103, "donAcc_type": "questionable", "distance": 3.337, "atom1_id": "///C/146/O", "atom2_id": "///C/149/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4084, "atom2_serNum": 4091, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///C/147/N", "atom2_id": "///C/147/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4108, "atom2_serNum": 4134, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///C/149/NZ", "atom2_id": "///C/153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4108, "atom2_serNum": 4168, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///C/149/NZ", "atom2_id": "///C/157/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4112, "atom2_serNum": 4136, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///C/150/O", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4119, "atom2_serNum": 4144, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/151/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4126, "atom2_serNum": 4153, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/152/O", "atom2_id": "///C/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4130, "atom2_serNum": 4161, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/153/O", "atom2_id": "///C/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4139, "atom2_serNum": 4170, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/154/O", "atom2_id": "///C/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4147, "atom2_serNum": 4181, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/155/O", "atom2_id": "///C/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4152, "atom2_serNum": 4381, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/155/NE2", "atom2_id": "///C/182/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4156, "atom2_serNum": 4193, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/156/O", "atom2_id": "///C/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4164, "atom2_serNum": 4202, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/157/O", "atom2_id": "///C/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4164, "atom2_serNum": 4207, "donAcc_type": "acceptable", "distance": 3.104, "atom1_id": "///C/157/O", "atom2_id": "///C/161/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4173, "atom2_serNum": 4209, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/158/O", "atom2_id": "///C/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4173, "atom2_serNum": 4221, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///C/158/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4179, "atom2_serNum": 4370, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/158/NH1", "atom2_id": "///C/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4184, "atom2_serNum": 4221, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///C/159/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4224, "atom2_serNum": 10505, "donAcc_type": "acceptable", "distance": 3.413, "atom1_id": "///C/163/O", "atom2_id": "///D/61/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 519, "atom1_serNum": 4234, "atom2_serNum": 10516, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/165/N", "atom2_id": "///D/62/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 520, "atom1_serNum": 4242, "atom2_serNum": 10516, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///C/166/N", "atom2_id": "///D/62/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 521, "atom1_serNum": 4253, "atom2_serNum": 10034, "donAcc_type": "standard", "distance": 2.419, "atom1_id": "///C/167/N", "atom2_id": "///D/20/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 522, "atom1_serNum": 4256, "atom2_serNum": 4375, "donAcc_type": "standard", "distance": 3.750, "atom1_id": "///C/167/O", "atom2_id": "///C/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4257, "atom2_serNum": 4263, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///C/168/N", "atom2_id": "///C/168/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4264, "atom2_serNum": 4357, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/168/OD2", "atom2_id": "///C/179/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4268, "atom2_serNum": 4359, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/169/O", "atom2_id": "///C/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4279, "atom2_serNum": 4281, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///C/170/O", "atom2_id": "///C/170/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4286, "atom2_serNum": 4341, "donAcc_type": "questionable", "distance": 3.348, "atom1_id": "///C/171/O", "atom2_id": "///C/178/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4299, "atom2_serNum": 4323, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///C/173/N", "atom2_id": "///C/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4404, "atom2_serNum": 4421, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///C/185/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4411, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/186/O", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4418, "atom2_serNum": 4449, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/187/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4418, "atom2_serNum": 4454, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///C/187/O", "atom2_id": "///C/191/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4424, "atom2_serNum": 4455, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/188/O", "atom2_id": "///C/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4429, "atom2_serNum": 4464, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/189/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4441, "atom2_serNum": 4469, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/190/O", "atom2_id": "///C/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4452, "atom2_serNum": 4477, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/191/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4458, "atom2_serNum": 4488, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/192/O", "atom2_id": "///C/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4467, "atom2_serNum": 4496, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/193/O", "atom2_id": "///C/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4472, "atom2_serNum": 4504, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/194/O", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4480, "atom2_serNum": 4513, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/195/O", "atom2_id": "///C/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4491, "atom2_serNum": 4518, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///C/196/O", "atom2_id": "///C/199/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4491, "atom2_serNum": 4520, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/196/O", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4499, "atom2_serNum": 4529, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/197/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4507, "atom2_serNum": 4538, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/198/O", "atom2_id": "///C/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4516, "atom2_serNum": 4547, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/199/O", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4523, "atom2_serNum": 4558, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///C/200/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4537, "atom2_serNum": 4603, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///C/201/NE2", "atom2_id": "///C/209/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4564, "atom2_serNum": 4566, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///C/204/OD1", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4564, "atom2_serNum": 4573, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/204/OD1", "atom2_id": "///C/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4576, "atom2_serNum": 4590, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///C/206/O", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4593, "atom2_serNum": 4625, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///C/208/O", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4600, "atom2_serNum": 4633, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/209/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4608, "atom2_serNum": 4641, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/210/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4617, "atom2_serNum": 4652, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/211/O", "atom2_id": "///C/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4628, "atom2_serNum": 4664, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/212/O", "atom2_id": "///C/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4636, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/213/O", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4644, "atom2_serNum": 4681, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/214/O", "atom2_id": "///C/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4655, "atom2_serNum": 4689, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/215/O", "atom2_id": "///C/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4667, "atom2_serNum": 4697, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///C/216/O", "atom2_id": "///C/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4667, "atom2_serNum": 4702, "donAcc_type": "acceptable", "distance": 3.189, "atom1_id": "///C/216/O", "atom2_id": "///C/220/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4700, "atom2_serNum": 4702, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///C/220/O", "atom2_id": "///C/220/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4716, "atom2_serNum": 9981, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///C/222/NZ", "atom2_id": "///D/17/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 563, "atom1_serNum": 4717, "atom2_serNum": 9972, "donAcc_type": "standard", "distance": 3.688, "atom1_id": "///C/223/N", "atom2_id": "///D/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 564, "atom1_serNum": 4720, "atom2_serNum": 9958, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///C/223/O", "atom2_id": "///D/16/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 565, "atom1_serNum": 4724, "atom2_serNum": 10859, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/223/NE", "atom2_id": "///D/78/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 566, "atom1_serNum": 4726, "atom2_serNum": 4774, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/223/NH1", "atom2_id": "///C/228/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4726, "atom2_serNum": 4785, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/223/NH1", "atom2_id": "///C/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4727, "atom2_serNum": 4785, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/223/NH2", "atom2_id": "///C/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4727, "atom2_serNum": 10859, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/223/NH2", "atom2_id": "///D/78/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 570, "atom1_serNum": 4728, "atom2_serNum": 4767, "donAcc_type": "acceptable", "distance": 3.947, "atom1_id": "///C/224/N", "atom2_id": "///C/227/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4731, "atom2_serNum": 4761, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/224/O", "atom2_id": "///C/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4740, "atom2_serNum": 9936, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///C/225/O", "atom2_id": "///D/15/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 573, "atom1_serNum": 4748, "atom2_serNum": 5959, "donAcc_type": "acceptable", "distance": 3.412, "atom1_id": "///C/225/OH", "atom2_id": "///C/383/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4752, "atom2_serNum": 4951, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///C/226/O", "atom2_id": "///C/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4760, "atom2_serNum": 5990, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///C/226/OH", "atom2_id": "///C/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4764, "atom2_serNum": 4860, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///C/227/O", "atom2_id": "///C/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4771, "atom2_serNum": 9936, "donAcc_type": "acceptable", "distance": 3.841, "atom1_id": "///C/228/N", "atom2_id": "///D/15/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 578, "atom1_serNum": 4782, "atom2_serNum": 10882, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/230/N", "atom2_id": "///D/79/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 579, "atom1_serNum": 4789, "atom2_serNum": 4818, "donAcc_type": "standard", "distance": 3.949, "atom1_id": "///C/231/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4792, "atom2_serNum": 10839, "donAcc_type": "questionable", "distance": 2.878, "atom1_id": "///C/231/OD1", "atom2_id": "///D/77/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 581, "atom1_serNum": 4797, "atom2_serNum": 4825, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///C/232/O", "atom2_id": "///C/235/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4802, "atom2_serNum": 4827, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/232/OE2", "atom2_id": "///C/235/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4811, "atom2_serNum": 10784, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///C/233/NZ", "atom2_id": "///D/74/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 584, "atom1_serNum": 4811, "atom2_serNum": 10797, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/233/NZ", "atom2_id": "///D/75/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 585, "atom1_serNum": 4817, "atom2_serNum": 10868, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///C/234/OG", "atom2_id": "///D/78/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 586, "atom1_serNum": 4828, "atom2_serNum": 4886, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///C/235/NH2", "atom2_id": "///C/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4832, "atom2_serNum": 4874, "donAcc_type": "questionable", "distance": 2.815, "atom1_id": "///C/236/O", "atom2_id": "///C/241/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4834, "atom2_serNum": 4844, "donAcc_type": "acceptable", "distance": 3.386, "atom1_id": "///C/236/OG1", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4834, "atom2_serNum": 10902, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///C/236/OG1", "atom2_id": "///D/80/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 590, "atom1_serNum": 4859, "atom2_serNum": 4890, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/239/O", "atom2_id": "///C/242/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4863, "atom2_serNum": 4927, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///C/240/O", "atom2_id": "///C/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4869, "atom2_serNum": 10855, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///C/240/NH1", "atom2_id": "///D/77/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 593, "atom1_serNum": 4882, "atom2_serNum": 10855, "donAcc_type": "acceptable", "distance": 2.904, "atom1_id": "///C/241/OH", "atom2_id": "///D/77/O4", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 594, "atom1_serNum": 4883, "atom2_serNum": 4914, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///C/242/N", "atom2_id": "///C/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4886, "atom2_serNum": 4907, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///C/242/O", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4946, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///C/250/O", "atom2_id": "///C/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4949, "atom2_serNum": 4951, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///C/250/OD1", "atom2_id": "///C/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4949, "atom2_serNum": 4959, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/250/OD1", "atom2_id": "///C/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4950, "atom2_serNum": 5952, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///C/250/ND2", "atom2_id": "///C/382/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4973, "atom2_serNum": 4990, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///C/253/O", "atom2_id": "///C/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4998, "atom2_serNum": 11749, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///C/257/N", "atom2_id": "///E/33/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 602, "atom1_serNum": 5001, "atom2_serNum": 5082, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///C/257/O", "atom2_id": "///C/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5011, "atom2_serNum": 5065, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///C/259/N", "atom2_id": "///C/265/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5020, "atom2_serNum": 6571, "donAcc_type": "acceptable", "distance": 3.801, "atom1_id": "///C/260/O", "atom2_id": "///C/458/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5022, "atom2_serNum": 9690, "donAcc_type": "acceptable", "distance": 3.243, "atom1_id": "///C/260/OG1", "atom2_id": "///D/4/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 606, "atom1_serNum": 5027, "atom2_serNum": 6560, "donAcc_type": "questionable", "distance": 3.316, "atom1_id": "///C/261/O", "atom2_id": "///C/457/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5038, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///C/262/O", "atom2_id": "///C/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5046, "atom2_serNum": 6375, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///C/262/OH", "atom2_id": "///C/434/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5046, "atom2_serNum": 6376, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///C/262/OH", "atom2_id": "///C/434/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5046, "atom2_serNum": 6547, "donAcc_type": "acceptable", "distance": 2.490, "atom1_id": "///C/262/OH", "atom2_id": "///C/455/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5091, "atom2_serNum": 11770, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///C/267/NH1", "atom2_id": "///E/34/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 612, "atom1_serNum": 5092, "atom2_serNum": 11771, "donAcc_type": "standard", "distance": 3.719, "atom1_id": "///C/267/NH2", "atom2_id": "///E/34/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 613, "atom1_serNum": 5093, "atom2_serNum": 6314, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/268/N", "atom2_id": "///C/427/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5096, "atom2_serNum": 6293, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///C/268/O", "atom2_id": "///C/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5101, "atom2_serNum": 5122, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///C/269/O", "atom2_id": "///C/272/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5103, "atom2_serNum": 6278, "donAcc_type": "standard", "distance": 3.625, "atom1_id": "///C/270/N", "atom2_id": "///C/423/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5111, "atom2_serNum": 9733, "donAcc_type": "standard", "distance": 3.610, "atom1_id": "///C/270/NZ", "atom2_id": "///D/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 618, "atom1_serNum": 5120, "atom2_serNum": 5154, "donAcc_type": "questionable", "distance": 3.061, "atom1_id": "///C/272/O", "atom2_id": "///C/276/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5122, "atom2_serNum": 5142, "donAcc_type": "acceptable", "distance": 3.436, "atom1_id": "///C/272/OG", "atom2_id": "///C/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5123, "atom2_serNum": 5880, "donAcc_type": "standard", "distance": 3.666, "atom1_id": "///C/273/N", "atom2_id": "///C/373/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5126, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/273/O", "atom2_id": "///C/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5138, "atom2_serNum": 5165, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/274/O", "atom2_id": "///C/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5145, "atom2_serNum": 5176, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/275/O", "atom2_id": "///C/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5145, "atom2_serNum": 5183, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///C/275/O", "atom2_id": "///C/279/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5150, "atom2_serNum": 5184, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/276/O", "atom2_id": "///C/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5154, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 3.898, "atom1_id": "///C/276/OE1", "atom2_id": "///C/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5155, "atom2_serNum": 5679, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///C/276/NE2", "atom2_id": "///C/350/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5159, "atom2_serNum": 5192, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/277/O", "atom2_id": "///C/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5163, "atom2_serNum": 5849, "donAcc_type": "standard", "distance": 2.422, "atom1_id": "///C/277/OE1", "atom2_id": "///C/369/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5164, "atom2_serNum": 6428, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///C/277/OE2", "atom2_id": "///C/440/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5168, "atom2_serNum": 5200, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/278/O", "atom2_id": "///C/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5179, "atom2_serNum": 5208, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/279/O", "atom2_id": "///C/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5182, "atom2_serNum": 6302, "donAcc_type": "standard", "distance": 3.512, "atom1_id": "///C/279/OD1", "atom2_id": "///C/425/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5187, "atom2_serNum": 5216, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/280/O", "atom2_id": "///C/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5195, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///C/281/O", "atom2_id": "///C/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5206, "atom2_serNum": 6469, "donAcc_type": "standard", "distance": 3.809, "atom1_id": "///C/282/OD1", "atom2_id": "///C/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5207, "atom2_serNum": 9699, "donAcc_type": "acceptable", "distance": 3.909, "atom1_id": "///C/282/ND2", "atom2_id": "///D/4/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 638, "atom1_serNum": 5215, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///C/283/OD2", "atom2_id": "///C/338/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5230, "atom2_serNum": 5297, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///C/285/OD1", "atom2_id": "///C/301/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5231, "atom2_serNum": 6412, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/285/ND2", "atom2_id": "///C/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5251, "atom2_serNum": 6450, "donAcc_type": "acceptable", "distance": 3.953, "atom1_id": "///C/296/O", "atom2_id": "///C/443/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5261, "atom2_serNum": 5280, "donAcc_type": "acceptable", "distance": 3.142, "atom1_id": "///C/297/OG", "atom2_id": "///C/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5265, "atom2_serNum": 5298, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/298/O", "atom2_id": "///C/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5265, "atom2_serNum": 5304, "donAcc_type": "questionable", "distance": 2.895, "atom1_id": "///C/298/O", "atom2_id": "///C/302/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5274, "atom2_serNum": 5306, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/299/O", "atom2_id": "///C/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5283, "atom2_serNum": 5315, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/300/O", "atom2_id": "///C/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5292, "atom2_serNum": 5323, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/301/O", "atom2_id": "///C/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5297, "atom2_serNum": 6412, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///C/301/NZ", "atom2_id": "///C/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5298, "atom2_serNum": 5304, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/302/N", "atom2_id": "///C/302/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5301, "atom2_serNum": 5331, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/302/O", "atom2_id": "///C/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5309, "atom2_serNum": 5339, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/303/O", "atom2_id": "///C/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5314, "atom2_serNum": 5470, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///C/303/NE2", "atom2_id": "///C/322/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5318, "atom2_serNum": 5351, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/304/O", "atom2_id": "///C/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5326, "atom2_serNum": 5358, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/305/O", "atom2_id": "///C/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5334, "atom2_serNum": 5367, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/306/O", "atom2_id": "///C/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5342, "atom2_serNum": 5375, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///C/307/O", "atom2_id": "///C/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5361, "atom2_serNum": 5749, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/309/O", "atom2_id": "///C/357/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5373, "atom2_serNum": 5812, "donAcc_type": "questionable", "distance": 3.255, "atom1_id": "///C/310/OD1", "atom2_id": "///C/365/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5387, "atom2_serNum": 5430, "donAcc_type": "standard", "distance": 3.821, "atom1_id": "///C/312/O", "atom2_id": "///C/318/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5413, "atom2_serNum": 5439, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/316/O", "atom2_id": "///C/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5420, "atom2_serNum": 5450, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/317/O", "atom2_id": "///C/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5425, "atom2_serNum": 5459, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/318/O", "atom2_id": "///C/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5434, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/319/O", "atom2_id": "///C/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5442, "atom2_serNum": 5479, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/320/O", "atom2_id": "///C/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5453, "atom2_serNum": 5484, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///C/321/O", "atom2_id": "///C/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5462, "atom2_serNum": 5493, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/322/O", "atom2_id": "///C/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5474, "atom2_serNum": 5501, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///C/323/O", "atom2_id": "///C/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5482, "atom2_serNum": 5515, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/324/O", "atom2_id": "///C/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5482, "atom2_serNum": 5518, "donAcc_type": "questionable", "distance": 3.134, "atom1_id": "///C/324/O", "atom2_id": "///C/329/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5504, "atom2_serNum": 5514, "donAcc_type": "acceptable", "distance": 2.615, "atom1_id": "///C/327/O", "atom2_id": "///C/328/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5524, "atom2_serNum": 5536, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///C/330/O", "atom2_id": "///C/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5544, "atom2_serNum": 5565, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///C/333/O", "atom2_id": "///C/335/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5585, "atom2_serNum": 5642, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/338/O", "atom2_id": "///C/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5592, "atom2_serNum": 5649, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///C/338/NH2", "atom2_id": "///C/346/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5592, "atom2_serNum": 9738, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///C/338/NH2", "atom2_id": "///D/6/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 676, "atom1_serNum": 5601, "atom2_serNum": 5607, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///C/340/N", "atom2_id": "///C/340/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5607, "atom2_serNum": 5609, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///C/340/OD1", "atom2_id": "///C/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5607, "atom2_serNum": 5631, "donAcc_type": "questionable", "distance": 2.868, "atom1_id": "///C/340/OD1", "atom2_id": "///C/344/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5649, "atom2_serNum": 9742, "donAcc_type": "acceptable", "distance": 2.850, "atom1_id": "///C/346/OE1", "atom2_id": "///D/6/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 680, "atom1_serNum": 5654, "atom2_serNum": 5669, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///C/347/O", "atom2_id": "///C/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5668, "atom2_serNum": 9722, "donAcc_type": "acceptable", "distance": 2.971, "atom1_id": "///C/348/NE2", "atom2_id": "///D/5/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 682, "atom1_serNum": 5674, "atom2_serNum": 5723, "donAcc_type": "acceptable", "distance": 2.623, "atom1_id": "///C/349/OG1", "atom2_id": "///C/354/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5679, "atom2_serNum": 5696, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///C/350/O", "atom2_id": "///C/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5699, "atom2_serNum": 5733, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/352/O", "atom2_id": "///C/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5704, "atom2_serNum": 5741, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/353/O", "atom2_id": "///C/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5712, "atom2_serNum": 5800, "donAcc_type": "acceptable", "distance": 3.865, "atom1_id": "///C/353/OH", "atom2_id": "///C/364/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5749, "atom2_serNum": 5813, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///C/357/NZ", "atom2_id": "///C/365/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5838, "atom2_serNum": 5857, "donAcc_type": "questionable", "distance": 2.898, "atom1_id": "///C/368/OD2", "atom2_id": "///C/370/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5842, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///C/369/O", "atom2_id": "///C/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5853, "atom2_serNum": 5882, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/370/O", "atom2_id": "///C/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5858, "atom2_serNum": 5890, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///C/370/OE2", "atom2_id": "///C/374/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5862, "atom2_serNum": 5891, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/371/O", "atom2_id": "///C/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5869, "atom2_serNum": 5899, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/372/O", "atom2_id": "///C/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5877, "atom2_serNum": 5904, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/373/O", "atom2_id": "///C/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5885, "atom2_serNum": 5916, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/374/O", "atom2_id": "///C/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5894, "atom2_serNum": 5923, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/375/O", "atom2_id": "///C/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5902, "atom2_serNum": 5931, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/376/O", "atom2_id": "///C/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5902, "atom2_serNum": 5936, "donAcc_type": "acceptable", "distance": 2.377, "atom1_id": "///C/376/O", "atom2_id": "///C/380/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5907, "atom2_serNum": 5938, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///C/377/O", "atom2_id": "///C/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5926, "atom2_serNum": 6205, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///C/379/O", "atom2_id": "///C/413/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5964, "atom2_serNum": 5994, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/384/O", "atom2_id": "///C/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5973, "atom2_serNum": 6002, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/385/O", "atom2_id": "///C/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5980, "atom2_serNum": 6152, "donAcc_type": "standard", "distance": 3.917, "atom1_id": "///C/385/NH2", "atom2_id": "///C/407/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5984, "atom2_serNum": 6011, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/386/O", "atom2_id": "///C/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5993, "atom2_serNum": 6020, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/387/O", "atom2_id": "///C/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5997, "atom2_serNum": 6025, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/388/O", "atom2_id": "///C/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6005, "atom2_serNum": 6033, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/389/O", "atom2_id": "///C/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6010, "atom2_serNum": 6041, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///C/389/NE2", "atom2_id": "///C/393/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6014, "atom2_serNum": 6042, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///C/390/O", "atom2_id": "///C/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6023, "atom2_serNum": 6052, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/391/O", "atom2_id": "///C/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6064, "atom2_serNum": 6085, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/396/O", "atom2_id": "///C/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6088, "atom2_serNum": 6094, "donAcc_type": "acceptable", "distance": 2.752, "atom1_id": "///C/399/O", "atom2_id": "///C/400/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6106, "atom2_serNum": 6137, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/402/N", "atom2_id": "///C/405/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6109, "atom2_serNum": 6139, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///C/402/O", "atom2_id": "///C/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6115, "atom2_serNum": 6120, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/403/O", "atom2_id": "///C/403/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6115, "atom2_serNum": 6146, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/403/O", "atom2_id": "///C/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6124, "atom2_serNum": 6154, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/404/O", "atom2_id": "///C/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6133, "atom2_serNum": 6163, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/405/O", "atom2_id": "///C/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6142, "atom2_serNum": 6171, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/406/O", "atom2_id": "///C/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6149, "atom2_serNum": 6178, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/407/O", "atom2_id": "///C/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6157, "atom2_serNum": 6187, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/408/O", "atom2_id": "///C/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6166, "atom2_serNum": 6198, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/409/O", "atom2_id": "///C/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6174, "atom2_serNum": 6209, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/410/O", "atom2_id": "///C/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6181, "atom2_serNum": 6218, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/411/O", "atom2_id": "///C/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6190, "atom2_serNum": 6229, "donAcc_type": "questionable", "distance": 2.891, "atom1_id": "///C/412/O", "atom2_id": "///C/416/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6201, "atom2_serNum": 6236, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///C/413/O", "atom2_id": "///C/417/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6208, "atom2_serNum": 6236, "donAcc_type": "acceptable", "distance": 2.662, "atom1_id": "///C/413/NH2", "atom2_id": "///C/417/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6223, "atom2_serNum": 6229, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///C/416/N", "atom2_id": "///C/416/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6226, "atom2_serNum": 6251, "donAcc_type": "standard", "distance": 3.832, "atom1_id": "///C/416/O", "atom2_id": "///C/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6234, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///C/417/O", "atom2_id": "///C/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6240, "atom2_serNum": 6274, "donAcc_type": "standard", "distance": 3.854, "atom1_id": "///C/418/O", "atom2_id": "///C/422/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6274, "atom2_serNum": 9756, "donAcc_type": "standard", "distance": 3.620, "atom1_id": "///C/422/NZ", "atom2_id": "///D/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 733, "atom1_serNum": 6287, "atom2_serNum": 11729, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/424/NE1", "atom2_id": "///E/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 734, "atom1_serNum": 6296, "atom2_serNum": 6314, "donAcc_type": "questionable", "distance": 2.867, "atom1_id": "///C/425/O", "atom2_id": "///C/427/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6303, "atom2_serNum": 9713, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///C/426/N", "atom2_id": "///D/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 736, "atom1_serNum": 6310, "atom2_serNum": 9714, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/426/ND2", "atom2_id": "///D/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 737, "atom1_serNum": 6325, "atom2_serNum": 6352, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/428/O", "atom2_id": "///C/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6331, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/429/O", "atom2_id": "///C/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6338, "atom2_serNum": 6368, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/430/O", "atom2_id": "///C/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6347, "atom2_serNum": 6377, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/431/O", "atom2_id": "///C/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6380, "atom2_serNum": 6409, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///C/435/O", "atom2_id": "///C/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6396, "atom2_serNum": 6437, "donAcc_type": "questionable", "distance": 3.010, "atom1_id": "///C/437/O", "atom2_id": "///C/441/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6403, "atom2_serNum": 6443, "donAcc_type": "acceptable", "distance": 3.229, "atom1_id": "///C/438/O", "atom2_id": "///C/442/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6429, "atom2_serNum": 6437, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///C/441/N", "atom2_id": "///C/441/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6443, "atom2_serNum": 6526, "donAcc_type": "acceptable", "distance": 3.575, "atom1_id": "///C/442/OG1", "atom2_id": "///C/452/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6459, "atom2_serNum": 6523, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///C/444/OE2", "atom2_id": "///C/452/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6459, "atom2_serNum": 6526, "donAcc_type": "standard", "distance": 2.437, "atom1_id": "///C/444/OE2", "atom2_id": "///C/452/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6463, "atom2_serNum": 6493, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///C/445/O", "atom2_id": "///C/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6472, "atom2_serNum": 6501, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/446/O", "atom2_id": "///C/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6476, "atom2_serNum": 9679, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///C/446/OE1", "atom2_id": "///D/3/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 751, "atom1_serNum": 6477, "atom2_serNum": 9683, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///C/446/NE2", "atom2_id": "///D/3/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 752, "atom1_serNum": 6481, "atom2_serNum": 6509, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/447/O", "atom2_id": "///C/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6489, "atom2_serNum": 6514, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///C/448/O", "atom2_id": "///C/451/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6489, "atom2_serNum": 6516, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/448/O", "atom2_id": "///C/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6496, "atom2_serNum": 6527, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/449/O", "atom2_id": "///C/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6504, "atom2_serNum": 6539, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///C/450/O", "atom2_id": "///C/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6538, "atom2_serNum": 6548, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/454/O", "atom2_id": "///C/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6547, "atom2_serNum": 6565, "donAcc_type": "questionable", "distance": 3.254, "atom1_id": "///C/455/NZ", "atom2_id": "///C/457/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6551, "atom2_serNum": 6566, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///C/456/O", "atom2_id": "///C/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6569, "atom2_serNum": 6571, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///C/458/O", "atom2_id": "///C/458/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6583, "atom2_serNum": 6585, "donAcc_type": "acceptable", "distance": 2.788, "atom1_id": "///C/460/O", "atom2_id": "///C/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6585, "atom2_serNum": 6707, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///C/460/OG", "atom2_id": "///C/475/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6591, "atom2_serNum": 6604, "donAcc_type": "acceptable", "distance": 3.274, "atom1_id": "///C/461/OG", "atom2_id": "///C/463/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6595, "atom2_serNum": 6597, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///C/462/O", "atom2_id": "///C/462/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6609, "atom2_serNum": 7107, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///C/464/O", "atom2_id": "///C/705/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6614, "atom2_serNum": 11177, "donAcc_type": "standard", "distance": 2.397, "atom1_id": "///C/464/NZ", "atom2_id": "///D/110/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 767, "atom1_serNum": 6622, "atom2_serNum": 11200, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///C/466/N", "atom2_id": "///D/111/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 768, "atom1_serNum": 6630, "atom2_serNum": 11223, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///C/466/NZ", "atom2_id": "///D/112/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 769, "atom1_serNum": 6643, "atom2_serNum": 6857, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/468/N", "atom2_id": "///C/494/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6646, "atom2_serNum": 6858, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///C/468/O", "atom2_id": "///C/494/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6657, "atom2_serNum": 6677, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///C/469/OD1", "atom2_id": "///C/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6662, "atom2_serNum": 6693, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/470/O", "atom2_id": "///C/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6662, "atom2_serNum": 6698, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///C/470/O", "atom2_id": "///C/474/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6680, "atom2_serNum": 6708, "donAcc_type": "questionable", "distance": 2.849, "atom1_id": "///C/472/O", "atom2_id": "///C/475/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6688, "atom2_serNum": 6717, "donAcc_type": "questionable", "distance": 3.330, "atom1_id": "///C/473/O", "atom2_id": "///C/476/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6709, "atom2_serNum": 6717, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/476/N", "atom2_id": "///C/476/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6737, "atom2_serNum": 11809, "donAcc_type": "acceptable", "distance": 3.890, "atom1_id": "///C/478/OH", "atom2_id": "///E/36/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 778, "atom1_serNum": 6741, "atom2_serNum": 6767, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///C/479/O", "atom2_id": "///C/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6749, "atom2_serNum": 6772, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/480/O", "atom2_id": "///C/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6756, "atom2_serNum": 6781, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/481/O", "atom2_id": "///C/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6756, "atom2_serNum": 6786, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///C/481/O", "atom2_id": "///C/485/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6763, "atom2_serNum": 6787, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/482/O", "atom2_id": "///C/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6770, "atom2_serNum": 6794, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/483/O", "atom2_id": "///C/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6775, "atom2_serNum": 6805, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///C/484/O", "atom2_id": "///C/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6784, "atom2_serNum": 6814, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/485/O", "atom2_id": "///C/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6790, "atom2_serNum": 6819, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/486/O", "atom2_id": "///C/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6797, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///C/487/O", "atom2_id": "///C/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6808, "atom2_serNum": 6836, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/488/O", "atom2_id": "///C/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6817, "atom2_serNum": 6844, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///C/489/O", "atom2_id": "///C/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6822, "atom2_serNum": 6851, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/490/O", "atom2_id": "///C/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6830, "atom2_serNum": 6859, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/491/O", "atom2_id": "///C/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6835, "atom2_serNum": 11031, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///C/491/NZ", "atom2_id": "///D/86/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 793, "atom1_serNum": 6835, "atom2_serNum": 11052, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/491/NZ", "atom2_id": "///D/87/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 794, "atom1_serNum": 6839, "atom2_serNum": 6864, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/492/O", "atom2_id": "///C/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6847, "atom2_serNum": 6869, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/493/O", "atom2_id": "///C/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6854, "atom2_serNum": 6877, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/494/O", "atom2_id": "///C/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6862, "atom2_serNum": 6886, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/495/O", "atom2_id": "///C/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6867, "atom2_serNum": 6895, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/496/O", "atom2_id": "///C/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6872, "atom2_serNum": 6910, "donAcc_type": "questionable", "distance": 2.851, "atom1_id": "///C/497/O", "atom2_id": "///C/501/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6918, "atom2_serNum": 6919, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///C/502/OD2", "atom2_id": "///C/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6933, "atom2_serNum": 7140, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///C/504/O", "atom2_id": "///C/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6936, "atom2_serNum": 6945, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///C/504/OD1", "atom2_id": "///C/505/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6945, "atom2_serNum": 7143, "donAcc_type": "standard", "distance": 3.857, "atom1_id": "///C/505/ND2", "atom2_id": "///C/710/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6946, "atom2_serNum": 7143, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/506/N", "atom2_id": "///C/710/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6949, "atom2_serNum": 7156, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/506/O", "atom2_id": "///C/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6961, "atom2_serNum": 7159, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/508/N", "atom2_id": "///C/712/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6964, "atom2_serNum": 7169, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///C/508/O", "atom2_id": "///C/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6981, "atom2_serNum": 7007, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///C/690/O", "atom2_id": "///C/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6986, "atom2_serNum": 7014, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/691/O", "atom2_id": "///C/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6992, "atom2_serNum": 7022, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///C/692/O", "atom2_id": "///C/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 7003, "atom2_serNum": 7030, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///C/693/O", "atom2_id": "///C/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 7010, "atom2_serNum": 7035, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/694/O", "atom2_id": "///C/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 7017, "atom2_serNum": 7043, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/695/O", "atom2_id": "///C/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 7025, "atom2_serNum": 7052, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/696/O", "atom2_id": "///C/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 7033, "atom2_serNum": 7061, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/697/O", "atom2_id": "///C/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 7038, "atom2_serNum": 7071, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/698/O", "atom2_id": "///C/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 7046, "atom2_serNum": 7082, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/699/O", "atom2_id": "///C/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 7055, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/700/O", "atom2_id": "///C/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 7064, "atom2_serNum": 7098, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///C/701/O", "atom2_id": "///C/705/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 7074, "atom2_serNum": 7117, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/702/O", "atom2_id": "///C/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 7120, "atom2_serNum": 7133, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///C/707/O", "atom2_id": "///C/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 7159, "atom2_serNum": 7161, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///C/712/O", "atom2_id": "///C/712/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 7196, "atom2_serNum": 7207, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/807/O", "atom2_id": "///C/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 7215, "atom2_serNum": 9187, "donAcc_type": "acceptable", "distance": 3.468, "atom1_id": "///C/810/N", "atom2_id": "///C/1061/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 7229, "atom2_serNum": 7231, "donAcc_type": "acceptable", "distance": 2.755, "atom1_id": "///C/811/O", "atom2_id": "///C/811/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 7243, "atom2_serNum": 9179, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///C/812/OH", "atom2_id": "///C/1061/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 7247, "atom2_serNum": 8883, "donAcc_type": "standard", "distance": 3.959, "atom1_id": "///C/813/O", "atom2_id": "///C/1026/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 7252, "atom2_serNum": 11011, "donAcc_type": "standard", "distance": 3.890, "atom1_id": "///C/813/NE2", "atom2_id": "///D/85/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 829, "atom1_serNum": 7256, "atom2_serNum": 11045, "donAcc_type": "questionable", "distance": 2.903, "atom1_id": "///C/814/O", "atom2_id": "///D/86/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 830, "atom1_serNum": 7260, "atom2_serNum": 8870, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///C/815/N", "atom2_id": "///C/1025/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 7263, "atom2_serNum": 8867, "donAcc_type": "standard", "distance": 3.805, "atom1_id": "///C/815/O", "atom2_id": "///C/1025/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7267, "atom2_serNum": 7312, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///C/815/OD2", "atom2_id": "///C/820/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7277, "atom2_serNum": 8545, "donAcc_type": "acceptable", "distance": 3.715, "atom1_id": "///C/817/O", "atom2_id": "///C/985/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7282, "atom2_serNum": 10968, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///C/817/NZ", "atom2_id": "///D/83/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 835, "atom1_serNum": 7286, "atom2_serNum": 8638, "donAcc_type": "acceptable", "distance": 3.990, "atom1_id": "///C/818/O", "atom2_id": "///C/997/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7300, "atom2_serNum": 10685, "donAcc_type": "standard", "distance": 3.625, "atom1_id": "///C/819/OD1", "atom2_id": "///D/69/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 837, "atom1_serNum": 7301, "atom2_serNum": 10931, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///C/819/ND2", "atom2_id": "///D/81/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 838, "atom1_serNum": 7305, "atom2_serNum": 10663, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/820/O", "atom2_id": "///D/68/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 839, "atom1_serNum": 7311, "atom2_serNum": 10967, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/820/NH1", "atom2_id": "///D/83/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 840, "atom1_serNum": 7311, "atom2_serNum": 10990, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///C/820/NH1", "atom2_id": "///D/84/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 841, "atom1_serNum": 7312, "atom2_serNum": 10990, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/820/NH2", "atom2_id": "///D/84/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 842, "atom1_serNum": 7316, "atom2_serNum": 8356, "donAcc_type": "acceptable", "distance": 3.841, "atom1_id": "///C/821/O", "atom2_id": "///C/963/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7321, "atom2_serNum": 7343, "donAcc_type": "standard", "distance": 3.909, "atom1_id": "///C/821/NZ", "atom2_id": "///C/824/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7322, "atom2_serNum": 10660, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/822/N", "atom2_id": "///D/68/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 845, "atom1_serNum": 7325, "atom2_serNum": 8351, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///C/822/O", "atom2_id": "///C/963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7335, "atom2_serNum": 7339, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///C/823/OG", "atom2_id": "///C/824/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7336, "atom2_serNum": 8332, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///C/824/N", "atom2_id": "///C/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7344, "atom2_serNum": 11568, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/825/N", "atom2_id": "///E/24/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 849, "atom1_serNum": 7352, "atom2_serNum": 7354, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///C/826/O", "atom2_id": "///C/826/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7359, "atom2_serNum": 10086, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///C/827/O", "atom2_id": "///D/22/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 851, "atom1_serNum": 7364, "atom2_serNum": 8317, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/828/N", "atom2_id": "///C/958/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7367, "atom2_serNum": 8314, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/828/O", "atom2_id": "///C/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7379, "atom2_serNum": 7507, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/829/O", "atom2_id": "///C/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7381, "atom2_serNum": 8301, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/830/N", "atom2_id": "///C/956/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7386, "atom2_serNum": 8301, "donAcc_type": "acceptable", "distance": 2.362, "atom1_id": "///C/830/OG1", "atom2_id": "///C/956/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7388, "atom2_serNum": 7491, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/831/N", "atom2_id": "///C/844/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7391, "atom2_serNum": 7488, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/831/O", "atom2_id": "///C/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7397, "atom2_serNum": 10117, "donAcc_type": "standard", "distance": 3.662, "atom1_id": "///C/831/NH1", "atom2_id": "///D/24/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 859, "atom1_serNum": 7407, "atom2_serNum": 7486, "donAcc_type": "acceptable", "distance": 3.518, "atom1_id": "///C/832/NE2", "atom2_id": "///C/843/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7408, "atom2_serNum": 7475, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/833/N", "atom2_id": "///C/842/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7411, "atom2_serNum": 7472, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/833/O", "atom2_id": "///C/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7416, "atom2_serNum": 7772, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///C/834/O", "atom2_id": "///C/876/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7425, "atom2_serNum": 7499, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///C/835/O", "atom2_id": "///C/844/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7432, "atom2_serNum": 7442, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/836/O", "atom2_id": "///C/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7479, "atom2_serNum": 8190, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///C/842/OE1", "atom2_id": "///C/941/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7484, "atom2_serNum": 8191, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///C/843/O", "atom2_id": "///C/942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7500, "atom2_serNum": 8179, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/845/N", "atom2_id": "///C/940/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7503, "atom2_serNum": 8168, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///C/845/O", "atom2_id": "///C/939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7503, "atom2_serNum": 8176, "donAcc_type": "standard", "distance": 3.705, "atom1_id": "///C/845/O", "atom2_id": "///C/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7515, "atom2_serNum": 8147, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/847/N", "atom2_id": "///C/937/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7518, "atom2_serNum": 8144, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///C/847/O", "atom2_id": "///C/937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7527, "atom2_serNum": 10077, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///C/848/NZ", "atom2_id": "///D/22/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 873, "atom1_serNum": 7527, "atom2_serNum": 10098, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///C/848/NZ", "atom2_id": "///D/23/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 874, "atom1_serNum": 7528, "atom2_serNum": 8130, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///C/849/N", "atom2_id": "///C/935/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7531, "atom2_serNum": 8127, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///C/849/O", "atom2_id": "///C/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7551, "atom2_serNum": 7553, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/851/OD1", "atom2_id": "///C/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7551, "atom2_serNum": 7561, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///C/851/OD1", "atom2_id": "///C/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7572, "atom2_serNum": 8008, "donAcc_type": "acceptable", "distance": 3.267, "atom1_id": "///C/853/OH", "atom2_id": "///C/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7572, "atom2_serNum": 8107, "donAcc_type": "acceptable", "distance": 2.808, "atom1_id": "///C/853/OH", "atom2_id": "///C/932/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7576, "atom2_serNum": 7601, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///C/854/O", "atom2_id": "///C/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7583, "atom2_serNum": 7613, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///C/855/O", "atom2_id": "///C/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7587, "atom2_serNum": 7619, "donAcc_type": "questionable", "distance": 2.962, "atom1_id": "///C/855/OE1", "atom2_id": "///C/859/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7592, "atom2_serNum": 7621, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/856/O", "atom2_id": "///C/860/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7600, "atom2_serNum": 7626, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/857/O", "atom2_id": "///C/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7604, "atom2_serNum": 7637, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/858/O", "atom2_id": "///C/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7616, "atom2_serNum": 7645, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/859/O", "atom2_id": "///C/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7624, "atom2_serNum": 7654, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/860/O", "atom2_id": "///C/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7629, "atom2_serNum": 7662, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/861/O", "atom2_id": "///C/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7640, "atom2_serNum": 7674, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/862/O", "atom2_id": "///C/866/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7648, "atom2_serNum": 7683, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///C/863/O", "atom2_id": "///C/867/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7657, "atom2_serNum": 7692, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/864/O", "atom2_id": "///C/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7691, "atom2_serNum": 12080, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///C/867/NZ", "atom2_id": "///G/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 893, "atom1_serNum": 7695, "atom2_serNum": 7715, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///C/868/O", "atom2_id": "///C/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7698, "atom2_serNum": 7700, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/868/OD1", "atom2_id": "///C/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7698, "atom2_serNum": 7709, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///C/868/OD1", "atom2_id": "///C/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7698, "atom2_serNum": 7714, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///C/868/OD1", "atom2_id": "///C/870/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7703, "atom2_serNum": 7724, "donAcc_type": "standard", "distance": 3.687, "atom1_id": "///C/869/O", "atom2_id": "///C/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7712, "atom2_serNum": 7773, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///C/870/O", "atom2_id": "///C/876/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7718, "atom2_serNum": 8156, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///C/871/O", "atom2_id": "///C/938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7735, "atom2_serNum": 8138, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///C/873/N", "atom2_id": "///C/936/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7738, "atom2_serNum": 7774, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///C/873/O", "atom2_id": "///C/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7746, "atom2_serNum": 7784, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/874/O", "atom2_id": "///C/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7780, "atom2_serNum": 10439, "donAcc_type": "acceptable", "distance": 3.423, "atom1_id": "///C/877/ND1", "atom2_id": "///D/58/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 904, "atom1_serNum": 7787, "atom2_serNum": 7815, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///C/878/O", "atom2_id": "///C/882/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7791, "atom2_serNum": 7813, "donAcc_type": "acceptable", "distance": 2.297, "atom1_id": "///C/878/OD2", "atom2_id": "///C/881/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7795, "atom2_serNum": 7826, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/879/O", "atom2_id": "///C/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7802, "atom2_serNum": 7834, "donAcc_type": "questionable", "distance": 3.042, "atom1_id": "///C/880/O", "atom2_id": "///C/883/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7802, "atom2_serNum": 7835, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///C/880/O", "atom2_id": "///C/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7811, "atom2_serNum": 7844, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/881/O", "atom2_id": "///C/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7813, "atom2_serNum": 8036, "donAcc_type": "acceptable", "distance": 3.848, "atom1_id": "///C/881/OG1", "atom2_id": "///C/923/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7818, "atom2_serNum": 7851, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/882/O", "atom2_id": "///C/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7829, "atom2_serNum": 7859, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/883/O", "atom2_id": "///C/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7833, "atom2_serNum": 7867, "donAcc_type": "questionable", "distance": 2.891, "atom1_id": "///C/883/OE1", "atom2_id": "///C/887/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7847, "atom2_serNum": 7875, "donAcc_type": "standard", "distance": 3.754, "atom1_id": "///C/885/O", "atom2_id": "///C/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7854, "atom2_serNum": 7883, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///C/886/O", "atom2_id": "///C/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7862, "atom2_serNum": 7891, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/887/O", "atom2_id": "///C/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7871, "atom2_serNum": 7900, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///C/888/O", "atom2_id": "///C/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7911, "atom2_serNum": 7943, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/909/O", "atom2_id": "///C/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7918, "atom2_serNum": 7955, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/910/O", "atom2_id": "///C/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7929, "atom2_serNum": 7964, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/911/O", "atom2_id": "///C/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7937, "atom2_serNum": 7973, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/912/O", "atom2_id": "///C/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7946, "atom2_serNum": 7982, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/913/O", "atom2_id": "///C/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7958, "atom2_serNum": 7992, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/914/O", "atom2_id": "///C/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7999, "atom2_serNum": 8016, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///C/919/O", "atom2_id": "///C/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 8011, "atom2_serNum": 8104, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///C/920/O", "atom2_id": "///C/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 8026, "atom2_serNum": 8087, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///C/921/NH2", "atom2_id": "///C/929/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 8027, "atom2_serNum": 8091, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///C/922/N", "atom2_id": "///C/930/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 8035, "atom2_serNum": 10255, "donAcc_type": "standard", "distance": 2.468, "atom1_id": "///C/922/NZ", "atom2_id": "///D/30/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 929, "atom1_serNum": 8035, "atom2_serNum": 10447, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///C/922/NZ", "atom2_id": "///D/58/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 930, "atom1_serNum": 8035, "atom2_serNum": 10448, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/922/NZ", "atom2_id": "///D/58/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 931, "atom1_serNum": 8053, "atom2_serNum": 8066, "donAcc_type": "acceptable", "distance": 2.507, "atom1_id": "///C/924/OG", "atom2_id": "///C/926/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 8053, "atom2_serNum": 8082, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///C/924/OG", "atom2_id": "///C/928/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 8054, "atom2_serNum": 10262, "donAcc_type": "standard", "distance": 3.554, "atom1_id": "///C/925/N", "atom2_id": "///D/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 934, "atom1_serNum": 8076, "atom2_serNum": 8082, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///C/928/N", "atom2_id": "///C/928/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 8082, "atom2_serNum": 8084, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///C/928/OD1", "atom2_id": "///C/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 8098, "atom2_serNum": 10463, "donAcc_type": "acceptable", "distance": 2.378, "atom1_id": "///C/931/O", "atom2_id": "///D/59/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 937, "atom1_serNum": 8103, "atom2_serNum": 8120, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///C/931/OE2", "atom2_id": "///C/933/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 8112, "atom2_serNum": 10474, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///C/933/N", "atom2_id": "///D/60/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 939, "atom1_serNum": 8121, "atom2_serNum": 10474, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/934/N", "atom2_id": "///D/60/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 940, "atom1_serNum": 8126, "atom2_serNum": 10474, "donAcc_type": "acceptable", "distance": 2.583, "atom1_id": "///C/934/OG", "atom2_id": "///D/60/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 941, "atom1_serNum": 8135, "atom2_serNum": 10454, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///C/936/N", "atom2_id": "///D/59/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 942, "atom1_serNum": 8182, "atom2_serNum": 12059, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/941/N", "atom2_id": "///G/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 943, "atom1_serNum": 8203, "atom2_serNum": 12038, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///C/944/N", "atom2_id": "///G/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 944, "atom1_serNum": 8209, "atom2_serNum": 8211, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///C/944/OD1", "atom2_id": "///C/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 8210, "atom2_serNum": 12016, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/944/ND2", "atom2_id": "///G/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 946, "atom1_serNum": 8221, "atom2_serNum": 8324, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/946/N", "atom2_id": "///C/959/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 8224, "atom2_serNum": 8321, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/946/O", "atom2_id": "///C/959/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8235, "atom2_serNum": 8245, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///C/947/OD1", "atom2_id": "///C/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 8235, "atom2_serNum": 8250, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///C/947/OD1", "atom2_id": "///C/949/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8235, "atom2_serNum": 8310, "donAcc_type": "questionable", "distance": 3.326, "atom1_id": "///C/947/OD1", "atom2_id": "///C/957/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 8237, "atom2_serNum": 8310, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///C/948/N", "atom2_id": "///C/957/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 8245, "atom2_serNum": 8310, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///C/949/N", "atom2_id": "///C/957/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 8250, "atom2_serNum": 8307, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///C/949/OG1", "atom2_id": "///C/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 8268, "atom2_serNum": 8274, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///C/952/N", "atom2_id": "///C/952/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8281, "atom2_serNum": 8290, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///C/953/OG", "atom2_id": "///C/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8281, "atom2_serNum": 8293, "donAcc_type": "acceptable", "distance": 2.865, "atom1_id": "///C/953/OG", "atom2_id": "///C/955/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8288, "atom2_serNum": 8290, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///C/954/OD1", "atom2_id": "///C/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8341, "atom2_serNum": 8343, "donAcc_type": "acceptable", "distance": 2.612, "atom1_id": "///C/961/O", "atom2_id": "///C/961/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8344, "atom2_serNum": 12016, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///C/962/N", "atom2_id": "///G/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 960, "atom1_serNum": 8354, "atom2_serNum": 8534, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///C/963/O", "atom2_id": "///C/985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8364, "atom2_serNum": 8520, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/965/N", "atom2_id": "///C/983/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8381, "atom2_serNum": 8517, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///C/966/O", "atom2_id": "///C/983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8385, "atom2_serNum": 8400, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///C/966/NE", "atom2_id": "///C/968/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8387, "atom2_serNum": 9614, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///C/966/NH1", "atom2_id": "///C/1118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8388, "atom2_serNum": 8866, "donAcc_type": "acceptable", "distance": 3.526, "atom1_id": "///C/966/NH2", "atom2_id": "///C/1024/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8388, "atom2_serNum": 9614, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///C/966/NH2", "atom2_id": "///C/1118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8389, "atom2_serNum": 8850, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/967/N", "atom2_id": "///C/1023/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8392, "atom2_serNum": 8847, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/967/O", "atom2_id": "///C/1023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8394, "atom2_serNum": 8508, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///C/968/N", "atom2_id": "///C/981/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8397, "atom2_serNum": 8505, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///C/968/O", "atom2_id": "///C/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8401, "atom2_serNum": 8700, "donAcc_type": "acceptable", "distance": 2.486, "atom1_id": "///C/968/OD2", "atom2_id": "///C/1004/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8402, "atom2_serNum": 8832, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///C/969/N", "atom2_id": "///C/1021/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8405, "atom2_serNum": 8820, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/969/O", "atom2_id": "///C/1020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8405, "atom2_serNum": 8829, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///C/969/O", "atom2_id": "///C/1021/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8409, "atom2_serNum": 8491, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///C/970/N", "atom2_id": "///C/979/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8412, "atom2_serNum": 8488, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/970/O", "atom2_id": "///C/979/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8420, "atom2_serNum": 8700, "donAcc_type": "acceptable", "distance": 3.354, "atom1_id": "///C/970/OH", "atom2_id": "///C/1004/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8421, "atom2_serNum": 8803, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///C/971/N", "atom2_id": "///C/1018/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8424, "atom2_serNum": 8800, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/971/O", "atom2_id": "///C/1018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8432, "atom2_serNum": 8438, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///C/972/N", "atom2_id": "///C/972/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8435, "atom2_serNum": 8463, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///C/972/O", "atom2_id": "///C/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8438, "atom2_serNum": 8470, "donAcc_type": "questionable", "distance": 3.066, "atom1_id": "///C/972/OD1", "atom2_id": "///C/977/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8439, "atom2_serNum": 8461, "donAcc_type": "acceptable", "distance": 3.592, "atom1_id": "///C/972/ND2", "atom2_id": "///C/975/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8443, "atom2_serNum": 8454, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///C/973/O", "atom2_id": "///C/974/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8495, "atom2_serNum": 8799, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///C/979/OE1", "atom2_id": "///C/1017/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8497, "atom2_serNum": 9120, "donAcc_type": "acceptable", "distance": 3.209, "atom1_id": "///C/980/N", "atom2_id": "///C/1054/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8537, "atom2_serNum": 8638, "donAcc_type": "acceptable", "distance": 3.809, "atom1_id": "///C/985/O", "atom2_id": "///C/997/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8570, "atom2_serNum": 8623, "donAcc_type": "questionable", "distance": 3.354, "atom1_id": "///C/989/O", "atom2_id": "///C/996/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8570, "atom2_serNum": 8639, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///C/989/O", "atom2_id": "///C/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8579, "atom2_serNum": 10700, "donAcc_type": "acceptable", "distance": 3.627, "atom1_id": "///C/990/O", "atom2_id": "///D/70/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 991, "atom1_serNum": 8587, "atom2_serNum": 8623, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///C/991/N", "atom2_id": "///C/996/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8590, "atom2_serNum": 8616, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///C/991/O", "atom2_id": "///C/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8638, "atom2_serNum": 10686, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///C/997/OH", "atom2_id": "///D/69/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 994, "atom1_serNum": 8659, "atom2_serNum": 8689, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///C/1000/O", "atom2_id": "///C/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8661, "atom2_serNum": 8678, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///C/1000/OG", "atom2_id": "///C/1002/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8665, "atom2_serNum": 8701, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/1001/O", "atom2_id": "///C/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8671, "atom2_serNum": 8678, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///C/1002/N", "atom2_id": "///C/1002/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8674, "atom2_serNum": 8709, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/1002/O", "atom2_id": "///C/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8683, "atom2_serNum": 8717, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/1003/O", "atom2_id": "///C/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8692, "atom2_serNum": 8725, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/1004/O", "atom2_id": "///C/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8701, "atom2_serNum": 8707, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/1005/N", "atom2_id": "///C/1005/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8704, "atom2_serNum": 8734, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/1005/O", "atom2_id": "///C/1009/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8712, "atom2_serNum": 8743, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/1006/O", "atom2_id": "///C/1010/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8715, "atom2_serNum": 8742, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///C/1006/OD1", "atom2_id": "///C/1009/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8720, "atom2_serNum": 8752, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/1007/O", "atom2_id": "///C/1011/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8728, "atom2_serNum": 8765, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///C/1008/O", "atom2_id": "///C/1013/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8728, "atom2_serNum": 8768, "donAcc_type": "questionable", "distance": 3.312, "atom1_id": "///C/1008/O", "atom2_id": "///C/1013/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8737, "atom2_serNum": 8761, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///C/1009/O", "atom2_id": "///C/1012/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8760, "atom2_serNum": 9064, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///C/1011/OE2", "atom2_id": "///C/1047/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8775, "atom2_serNum": 8799, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///C/1014/O", "atom2_id": "///C/1017/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8779, "atom2_serNum": 8786, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///C/1014/OD2", "atom2_id": "///C/1016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8812, "atom2_serNum": 9572, "donAcc_type": "questionable", "distance": 3.282, "atom1_id": "///C/1019/O", "atom2_id": "///C/1112/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8823, "atom2_serNum": 9572, "donAcc_type": "questionable", "distance": 3.179, "atom1_id": "///C/1020/O", "atom2_id": "///C/1112/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8823, "atom2_serNum": 9574, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/1020/O", "atom2_id": "///C/1113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8843, "atom2_serNum": 9461, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/1022/O", "atom2_id": "///C/1098/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8855, "atom2_serNum": 8891, "donAcc_type": "standard", "distance": 3.773, "atom1_id": "///C/1024/N", "atom2_id": "///C/1027/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8858, "atom2_serNum": 8884, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///C/1024/O", "atom2_id": "///C/1027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8876, "atom2_serNum": 9032, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///C/1026/N", "atom2_id": "///C/1044/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8882, "atom2_serNum": 9027, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/1026/OD1", "atom2_id": "///C/1043/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8887, "atom2_serNum": 9029, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///C/1027/O", "atom2_id": "///C/1044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8890, "atom2_serNum": 8892, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/1027/OD1", "atom2_id": "///C/1028/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8895, "atom2_serNum": 9462, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/1028/O", "atom2_id": "///C/1099/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8900, "atom2_serNum": 9010, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/1029/N", "atom2_id": "///C/1042/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8903, "atom2_serNum": 9007, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///C/1029/O", "atom2_id": "///C/1042/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8908, "atom2_serNum": 9444, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///C/1030/N", "atom2_id": "///C/1097/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8911, "atom2_serNum": 9441, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/1030/O", "atom2_id": "///C/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8916, "atom2_serNum": 8993, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/1031/N", "atom2_id": "///C/1040/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8919, "atom2_serNum": 8990, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/1031/O", "atom2_id": "///C/1040/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8923, "atom2_serNum": 9430, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/1032/N", "atom2_id": "///C/1095/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8926, "atom2_serNum": 9427, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/1032/O", "atom2_id": "///C/1095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8931, "atom2_serNum": 9452, "donAcc_type": "acceptable", "distance": 3.886, "atom1_id": "///C/1032/NZ", "atom2_id": "///C/1097/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8932, "atom2_serNum": 8975, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/1033/N", "atom2_id": "///C/1038/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8938, "atom2_serNum": 8940, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///C/1033/OD1", "atom2_id": "///C/1034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8938, "atom2_serNum": 8947, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/1033/OD1", "atom2_id": "///C/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8938, "atom2_serNum": 8956, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///C/1033/OD1", "atom2_id": "///C/1036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8945, "atom2_serNum": 8955, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///C/1034/OG1", "atom2_id": "///C/1035/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8947, "atom2_serNum": 8955, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///C/1035/N", "atom2_id": "///C/1035/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8954, "atom2_serNum": 9418, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///C/1035/OE1", "atom2_id": "///C/1093/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8955, "atom2_serNum": 9418, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/1035/OE2", "atom2_id": "///C/1093/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8997, "atom2_serNum": 9273, "donAcc_type": "standard", "distance": 3.758, "atom1_id": "///C/1040/OE1", "atom2_id": "///C/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 9018, "atom2_serNum": 9163, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/1043/N", "atom2_id": "///C/1059/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 9021, "atom2_serNum": 9160, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/1043/O", "atom2_id": "///C/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 9025, "atom2_serNum": 9172, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///C/1043/NE", "atom2_id": "///C/1060/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 9028, "atom2_serNum": 9172, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///C/1043/NH2", "atom2_id": "///C/1060/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 9028, "atom2_serNum": 9199, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///C/1043/NH2", "atom2_id": "///C/1063/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 9040, "atom2_serNum": 9146, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/1045/N", "atom2_id": "///C/1057/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 9048, "atom2_serNum": 9146, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///C/1046/N", "atom2_id": "///C/1057/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 9051, "atom2_serNum": 9143, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/1046/O", "atom2_id": "///C/1057/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 9053, "atom2_serNum": 11996, "donAcc_type": "acceptable", "distance": 3.248, "atom1_id": "///C/1046/OG", "atom2_id": "///G/3/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1050, "atom1_serNum": 9063, "atom2_serNum": 9068, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///C/1047/NH1", "atom2_id": "///C/1048/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 9063, "atom2_serNum": 9099, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///C/1047/NH1", "atom2_id": "///C/1052/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 9063, "atom2_serNum": 9127, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///C/1047/NH1", "atom2_id": "///C/1055/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 9064, "atom2_serNum": 9099, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///C/1047/NH2", "atom2_id": "///C/1052/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 9075, "atom2_serNum": 9096, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///C/1049/O", "atom2_id": "///C/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 9104, "atom2_serNum": 11409, "donAcc_type": "standard", "distance": 3.790, "atom1_id": "///C/1052/NE2", "atom2_id": "///E/16/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1056, "atom1_serNum": 9117, "atom2_serNum": 9384, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///C/1054/O", "atom2_id": "///C/1089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 9135, "atom2_serNum": 11428, "donAcc_type": "acceptable", "distance": 3.031, "atom1_id": "///C/1055/OH", "atom2_id": "///E/17/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1058, "atom1_serNum": 9136, "atom2_serNum": 9374, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/1056/N", "atom2_id": "///C/1087/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 9139, "atom2_serNum": 9371, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/1056/O", "atom2_id": "///C/1087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 9152, "atom2_serNum": 9359, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/1058/N", "atom2_id": "///C/1085/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 9168, "atom2_serNum": 11977, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///C/1059/NZ", "atom2_id": "///G/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1062, "atom1_serNum": 9187, "atom2_serNum": 9530, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///C/1061/OH", "atom2_id": "///C/1107/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 9226, "atom2_serNum": 9258, "donAcc_type": "questionable", "distance": 2.847, "atom1_id": "///C/1066/O", "atom2_id": "///C/1070/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 9251, "atom2_serNum": 9259, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/1070/N", "atom2_id": "///C/1070/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 9254, "atom2_serNum": 9317, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///C/1070/O", "atom2_id": "///C/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 9265, "atom2_serNum": 9308, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///C/1072/N", "atom2_id": "///C/1077/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 9276, "atom2_serNum": 9305, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/1073/O", "atom2_id": "///C/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 9293, "atom2_serNum": 9404, "donAcc_type": "standard", "distance": 3.982, "atom1_id": "///C/1075/O", "atom2_id": "///C/1091/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 9312, "atom2_serNum": 9379, "donAcc_type": "standard", "distance": 2.400, "atom1_id": "///C/1078/O", "atom2_id": "///C/1087/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 9342, "atom2_serNum": 11468, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///C/1082/OG", "atom2_id": "///E/19/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1071, "atom1_serNum": 9354, "atom2_serNum": 9370, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///C/1084/OE1", "atom2_id": "///C/1086/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 9370, "atom2_serNum": 12028, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/1086/NZ", "atom2_id": "///G/4/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1073, "atom1_serNum": 9379, "atom2_serNum": 11448, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///C/1087/NZ", "atom2_id": "///E/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1074, "atom1_serNum": 9383, "atom2_serNum": 9404, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///C/1088/O", "atom2_id": "///C/1091/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 9453, "atom2_serNum": 9552, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/1098/N", "atom2_id": "///C/1110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9456, "atom2_serNum": 9549, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/1098/O", "atom2_id": "///C/1110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9461, "atom2_serNum": 9479, "donAcc_type": "questionable", "distance": 3.063, "atom1_id": "///C/1098/NZ", "atom2_id": "///C/1100/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9469, "atom2_serNum": 9534, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/1100/N", "atom2_id": "///C/1108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9472, "atom2_serNum": 9531, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/1100/O", "atom2_id": "///C/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9478, "atom2_serNum": 11082, "donAcc_type": "acceptable", "distance": 2.688, "atom1_id": "///C/1100/NH1", "atom2_id": "///D/88/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1081, "atom1_serNum": 9490, "atom2_serNum": 9510, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/1102/O", "atom2_id": "///C/1105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9493, "atom2_serNum": 9502, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/1102/OD1", "atom2_id": "///C/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9513, "atom2_serNum": 9529, "donAcc_type": "questionable", "distance": 3.336, "atom1_id": "///C/1105/O", "atom2_id": "///C/1107/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9522, "atom2_serNum": 9529, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/1107/N", "atom2_id": "///C/1107/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9572, "atom2_serNum": 9574, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/1112/OD1", "atom2_id": "///C/1113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9572, "atom2_serNum": 9586, "donAcc_type": "questionable", "distance": 3.288, "atom1_id": "///C/1112/OD1", "atom2_id": "///C/1114/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9607, "atom2_serNum": 9620, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///C/1117/O", "atom2_id": "///C/1119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9664, "atom2_serNum": 11948, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///D/2/N3", "atom2_id": "///E/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1089, "atom1_serNum": 9666, "atom2_serNum": 11947, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///D/2/O4", "atom2_id": "///E/42/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1090, "atom1_serNum": 9684, "atom2_serNum": 11927, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///D/3/N3", "atom2_id": "///E/41/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1091, "atom1_serNum": 9686, "atom2_serNum": 11926, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/3/O4", "atom2_id": "///E/41/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1092, "atom1_serNum": 9706, "atom2_serNum": 11907, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/4/O6", "atom2_id": "///E/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1093, "atom1_serNum": 9707, "atom2_serNum": 11905, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/4/N1", "atom2_id": "///E/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1094, "atom1_serNum": 9709, "atom2_serNum": 11904, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///D/4/N2", "atom2_id": "///E/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1095, "atom1_serNum": 9726, "atom2_serNum": 11888, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///D/5/O2", "atom2_id": "///E/39/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1096, "atom1_serNum": 9727, "atom2_serNum": 11886, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///D/5/N3", "atom2_id": "///E/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1097, "atom1_serNum": 9729, "atom2_serNum": 11885, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///D/5/N4", "atom2_id": "///E/39/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1098, "atom1_serNum": 9749, "atom2_serNum": 11866, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///D/6/O6", "atom2_id": "///E/38/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1099, "atom1_serNum": 9750, "atom2_serNum": 11864, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/6/N1", "atom2_id": "///E/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1100, "atom1_serNum": 9752, "atom2_serNum": 11863, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///D/6/N2", "atom2_id": "///E/38/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1101, "atom1_serNum": 9770, "atom2_serNum": 11846, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/7/N3", "atom2_id": "///E/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1102, "atom1_serNum": 9772, "atom2_serNum": 11845, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///D/7/O4", "atom2_id": "///E/37/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1103, "atom1_serNum": 9785, "atom2_serNum": 9797, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///D/8/O2'", "atom2_id": "///D/9/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1104, "atom1_serNum": 9790, "atom2_serNum": 11825, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///D/8/N3", "atom2_id": "///E/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1105, "atom1_serNum": 9792, "atom2_serNum": 11824, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/8/O4", "atom2_id": "///E/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1106, "atom1_serNum": 9812, "atom2_serNum": 11805, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///D/9/O6", "atom2_id": "///E/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1107, "atom1_serNum": 9813, "atom2_serNum": 11803, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/9/N1", "atom2_id": "///E/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1108, "atom1_serNum": 9815, "atom2_serNum": 11802, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/9/N2", "atom2_id": "///E/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1109, "atom1_serNum": 9835, "atom2_serNum": 11785, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///D/10/N6", "atom2_id": "///E/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1110, "atom1_serNum": 9836, "atom2_serNum": 11783, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///D/10/N1", "atom2_id": "///E/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1111, "atom1_serNum": 9855, "atom2_serNum": 11765, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/11/N3", "atom2_id": "///E/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1112, "atom1_serNum": 9857, "atom2_serNum": 11764, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///D/11/O4", "atom2_id": "///E/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1113, "atom1_serNum": 9877, "atom2_serNum": 11744, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///D/12/N6", "atom2_id": "///E/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1114, "atom1_serNum": 9878, "atom2_serNum": 11742, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///D/12/N1", "atom2_id": "///E/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1115, "atom1_serNum": 9899, "atom2_serNum": 11724, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///D/13/N6", "atom2_id": "///E/31/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1116, "atom1_serNum": 9900, "atom2_serNum": 11722, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///D/13/N1", "atom2_id": "///E/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1117, "atom1_serNum": 9922, "atom2_serNum": 11702, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///D/14/N1", "atom2_id": "///E/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1118, "atom1_serNum": 9943, "atom2_serNum": 11684, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///D/15/N6", "atom2_id": "///E/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1119, "atom1_serNum": 9944, "atom2_serNum": 11682, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///D/15/N1", "atom2_id": "///E/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1120, "atom1_serNum": 9965, "atom2_serNum": 11665, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/16/O6", "atom2_id": "///E/28/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1121, "atom1_serNum": 9966, "atom2_serNum": 11663, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///D/16/N1", "atom2_id": "///E/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1122, "atom1_serNum": 9968, "atom2_serNum": 11662, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/16/N2", "atom2_id": "///E/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1123, "atom1_serNum": 9986, "atom2_serNum": 11645, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///D/17/N3", "atom2_id": "///E/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1124, "atom1_serNum": 9988, "atom2_serNum": 11644, "donAcc_type": "standard", "distance": 3.820, "atom1_id": "///D/17/O4", "atom2_id": "///E/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1125, "atom1_serNum": 10009, "atom2_serNum": 11621, "donAcc_type": "questionable", "distance": 3.154, "atom1_id": "///D/18/N1", "atom2_id": "///E/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1126, "atom1_serNum": 10009, "atom2_serNum": 11622, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///D/18/N1", "atom2_id": "///E/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1127, "atom1_serNum": 10028, "atom2_serNum": 11604, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///D/19/N3", "atom2_id": "///E/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1128, "atom1_serNum": 10048, "atom2_serNum": 11583, "donAcc_type": "standard", "distance": 3.672, "atom1_id": "///D/20/N3", "atom2_id": "///E/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1129, "atom1_serNum": 10070, "atom2_serNum": 10641, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///D/21/O6", "atom2_id": "///D/67/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1130, "atom1_serNum": 10071, "atom2_serNum": 10640, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///D/21/N1", "atom2_id": "///D/67/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1131, "atom1_serNum": 10091, "atom2_serNum": 10622, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/22/N3", "atom2_id": "///D/66/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1132, "atom1_serNum": 10093, "atom2_serNum": 10621, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/22/O4", "atom2_id": "///D/66/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1133, "atom1_serNum": 10110, "atom2_serNum": 10599, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/23/O2", "atom2_id": "///D/65/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1134, "atom1_serNum": 10111, "atom2_serNum": 10598, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///D/23/N3", "atom2_id": "///D/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1135, "atom1_serNum": 10131, "atom2_serNum": 10577, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/24/N3", "atom2_id": "///D/64/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1136, "atom1_serNum": 10133, "atom2_serNum": 10576, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///D/24/O4", "atom2_id": "///D/64/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1137, "atom1_serNum": 10151, "atom2_serNum": 10555, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///D/25/N3", "atom2_id": "///D/63/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1138, "atom1_serNum": 10153, "atom2_serNum": 10554, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///D/25/O4", "atom2_id": "///D/63/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1139, "atom1_serNum": 10171, "atom2_serNum": 10533, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/26/N3", "atom2_id": "///D/62/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1140, "atom1_serNum": 10173, "atom2_serNum": 10532, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///D/26/O4", "atom2_id": "///D/62/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1141, "atom1_serNum": 10193, "atom2_serNum": 10512, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/27/O6", "atom2_id": "///D/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1142, "atom1_serNum": 10194, "atom2_serNum": 10510, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/27/N1", "atom2_id": "///D/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1143, "atom1_serNum": 10196, "atom2_serNum": 10509, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/27/N2", "atom2_id": "///D/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1144, "atom1_serNum": 10214, "atom2_serNum": 10491, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///D/28/N3", "atom2_id": "///D/60/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1145, "atom1_serNum": 10216, "atom2_serNum": 10490, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/28/O4", "atom2_id": "///D/60/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1146, "atom1_serNum": 10236, "atom2_serNum": 10470, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///D/29/N6", "atom2_id": "///D/59/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1147, "atom1_serNum": 10237, "atom2_serNum": 10468, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///D/29/N1", "atom2_id": "///D/59/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1148, "atom1_serNum": 10256, "atom2_serNum": 10450, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///D/30/N3", "atom2_id": "///D/58/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1149, "atom1_serNum": 10276, "atom2_serNum": 10384, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///D/31/N3", "atom2_id": "///D/55/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1150, "atom1_serNum": 10278, "atom2_serNum": 10383, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/31/O4", "atom2_id": "///D/55/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1151, "atom1_serNum": 10295, "atom2_serNum": 10363, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///D/32/O2", "atom2_id": "///D/54/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1152, "atom1_serNum": 10296, "atom2_serNum": 10361, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/32/N3", "atom2_id": "///D/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1153, "atom1_serNum": 10298, "atom2_serNum": 10360, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/32/N4", "atom2_id": "///D/54/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1154, "atom1_serNum": 10316, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///D/33/N3", "atom2_id": "///D/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1155, "atom1_serNum": 10318, "atom2_serNum": 10338, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/33/O4", "atom2_id": "///D/53/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1156, "atom1_serNum": 10664, "atom2_serNum": 10931, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///D/68/N1", "atom2_id": "///D/81/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1157, "atom1_serNum": 10670, "atom2_serNum": 10941, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///D/69/OP2", "atom2_id": "///D/81/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1158, "atom1_serNum": 10682, "atom2_serNum": 10941, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///D/69/N7", "atom2_id": "///D/81/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1159, "atom1_serNum": 10707, "atom2_serNum": 10918, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///D/70/O6", "atom2_id": "///D/80/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1160, "atom1_serNum": 10708, "atom2_serNum": 10916, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/70/N1", "atom2_id": "///D/80/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1161, "atom1_serNum": 10710, "atom2_serNum": 10915, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///D/70/N2", "atom2_id": "///D/80/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1162, "atom1_serNum": 10730, "atom2_serNum": 10898, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///D/71/O6", "atom2_id": "///D/79/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1163, "atom1_serNum": 10731, "atom2_serNum": 10896, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/71/N1", "atom2_id": "///D/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1164, "atom1_serNum": 10733, "atom2_serNum": 10895, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///D/71/N2", "atom2_id": "///D/79/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1165, "atom1_serNum": 10750, "atom2_serNum": 10878, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///D/72/O2", "atom2_id": "///D/78/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1166, "atom1_serNum": 10751, "atom2_serNum": 10876, "donAcc_type": "standard", "distance": 3.468, "atom1_id": "///D/72/N3", "atom2_id": "///D/78/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1167, "atom1_serNum": 10753, "atom2_serNum": 10875, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///D/72/N4", "atom2_id": "///D/78/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1168, "atom1_serNum": 10771, "atom2_serNum": 10834, "donAcc_type": "standard", "distance": 3.645, "atom1_id": "///D/73/N3", "atom2_id": "///D/76/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1169, "atom1_serNum": 10786, "atom2_serNum": 10790, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///D/74/O2'", "atom2_id": "///D/74/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1170, "atom1_serNum": 10786, "atom2_serNum": 10799, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///D/74/O2'", "atom2_id": "///D/75/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1171, "atom1_serNum": 10793, "atom2_serNum": 10878, "donAcc_type": "standard", "distance": 3.922, "atom1_id": "///D/74/O4", "atom2_id": "///D/78/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1172, "atom1_serNum": 10806, "atom2_serNum": 10810, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///D/75/O2'", "atom2_id": "///D/75/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1173, "atom1_serNum": 10826, "atom2_serNum": 10864, "donAcc_type": "acceptable", "distance": 3.400, "atom1_id": "///D/76/O2'", "atom2_id": "///D/78/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1174, "atom1_serNum": 11040, "atom2_serNum": 11052, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///D/86/O2'", "atom2_id": "///D/87/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1175, "atom1_serNum": 11060, "atom2_serNum": 11075, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///D/87/O2'", "atom2_id": "///D/88/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1176, "atom1_serNum": 11060, "atom2_serNum": 11078, "donAcc_type": "acceptable", "distance": 3.164, "atom1_id": "///D/87/O2'", "atom2_id": "///D/88/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1177, "atom1_serNum": 11068, "atom2_serNum": 11302, "donAcc_type": "questionable", "distance": 2.977, "atom1_id": "///D/87/N1", "atom2_id": "///D/115/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1178, "atom1_serNum": 11089, "atom2_serNum": 11282, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///D/88/N6", "atom2_id": "///D/114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1179, "atom1_serNum": 11090, "atom2_serNum": 11280, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/88/N1", "atom2_id": "///D/114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1180, "atom1_serNum": 11108, "atom2_serNum": 11262, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///D/89/O2", "atom2_id": "///D/113/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1181, "atom1_serNum": 11109, "atom2_serNum": 11260, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/89/N3", "atom2_id": "///D/113/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1182, "atom1_serNum": 11111, "atom2_serNum": 11259, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///D/89/N4", "atom2_id": "///D/113/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1183, "atom1_serNum": 11131, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 3.987, "atom1_id": "///D/90/N6", "atom2_id": "///D/112/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1184, "atom1_serNum": 11132, "atom2_serNum": 11237, "donAcc_type": "standard", "distance": 3.790, "atom1_id": "///D/90/N1", "atom2_id": "///D/112/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1185, "atom1_serNum": 11150, "atom2_serNum": 11219, "donAcc_type": "standard", "distance": 3.899, "atom1_id": "///D/91/O2", "atom2_id": "///D/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1186, "atom1_serNum": 11171, "atom2_serNum": 11196, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///D/92/N3", "atom2_id": "///D/110/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1187, "atom1_serNum": 11275, "atom2_serNum": 11279, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///D/114/O2'", "atom2_id": "///D/114/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1188, "atom1_serNum": 11275, "atom2_serNum": 11288, "donAcc_type": "acceptable", "distance": 2.794, "atom1_id": "///D/114/O2'", "atom2_id": "///D/115/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1189, "atom1_serNum": 11320, "atom2_serNum": 12222, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///E/11/N3", "atom2_id": "///G/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1190, "atom1_serNum": 11322, "atom2_serNum": 12221, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/11/O4", "atom2_id": "///G/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1191, "atom1_serNum": 11340, "atom2_serNum": 12201, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///E/12/N3", "atom2_id": "///G/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1192, "atom1_serNum": 11342, "atom2_serNum": 12200, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///E/12/O4", "atom2_id": "///G/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1193, "atom1_serNum": 11360, "atom2_serNum": 12180, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///E/13/N3", "atom2_id": "///G/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1194, "atom1_serNum": 11362, "atom2_serNum": 12179, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///E/13/O4", "atom2_id": "///G/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1195, "atom1_serNum": 11379, "atom2_serNum": 12160, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///E/14/O2", "atom2_id": "///G/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1196, "atom1_serNum": 11380, "atom2_serNum": 12158, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///E/14/N3", "atom2_id": "///G/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1197, "atom1_serNum": 11382, "atom2_serNum": 12157, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///E/14/N4", "atom2_id": "///G/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1198, "atom1_serNum": 11402, "atom2_serNum": 12135, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///E/15/N1", "atom2_id": "///G/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1199, "atom1_serNum": 11420, "atom2_serNum": 12117, "donAcc_type": "standard", "distance": 3.616, "atom1_id": "///E/16/N3", "atom2_id": "///G/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1200, "atom1_serNum": 11422, "atom2_serNum": 12116, "donAcc_type": "standard", "distance": 3.891, "atom1_id": "///E/16/O4", "atom2_id": "///G/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1201, "atom1_serNum": 11440, "atom2_serNum": 12096, "donAcc_type": "standard", "distance": 3.745, "atom1_id": "///E/17/N3", "atom2_id": "///G/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1202, "atom1_serNum": 11460, "atom2_serNum": 12075, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/18/N3", "atom2_id": "///G/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1203, "atom1_serNum": 11462, "atom2_serNum": 12074, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///E/18/O4", "atom2_id": "///G/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1204, "atom1_serNum": 11480, "atom2_serNum": 12054, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///E/19/N3", "atom2_id": "///G/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1205, "atom1_serNum": 11482, "atom2_serNum": 12053, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///E/19/O4", "atom2_id": "///G/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1206, "atom1_serNum": 11499, "atom2_serNum": 12034, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/20/O2", "atom2_id": "///G/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1207, "atom1_serNum": 11500, "atom2_serNum": 12032, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///E/20/N3", "atom2_id": "///G/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1208, "atom1_serNum": 11502, "atom2_serNum": 12031, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///E/20/N4", "atom2_id": "///G/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1209, "atom1_serNum": 11519, "atom2_serNum": 12011, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///E/21/N3", "atom2_id": "///G/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1210, "atom1_serNum": 11521, "atom2_serNum": 12010, "donAcc_type": "standard", "distance": 3.677, "atom1_id": "///E/21/O4", "atom2_id": "///G/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1211, "atom1_serNum": 11541, "atom2_serNum": 11991, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///E/22/O6", "atom2_id": "///G/2/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1212, "atom1_serNum": 11542, "atom2_serNum": 11989, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///E/22/N1", "atom2_id": "///G/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1213, "atom1_serNum": 11544, "atom2_serNum": 11988, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///E/22/N2", "atom2_id": "///G/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1214, "atom1_serNum": 11560, "atom2_serNum": 11972, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///E/23/O2", "atom2_id": "///G/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1215, "atom1_serNum": 11561, "atom2_serNum": 11970, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///E/23/N3", "atom2_id": "///G/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1216, "atom1_serNum": 11563, "atom2_serNum": 11969, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///E/23/N4", "atom2_id": "///G/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "https://x3dna.org/", "web_dssr": "https://web.x3dna-dssr.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6rjg", "num_aaChains": 3, "aaChains": "A=183,B=183,C=814", "num_naChains": 3, "naChains": "D=78,E=32,G=13", "num_atoms": 12220, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }