**************************************************************************** File name: 6rjg.pdb no. of DNA/RNA chains: 3 [D=78,E=32,G=13] no. of nucleotides: 123 no. of atoms: 12220 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 56 base pairs nt1 nt2 bp name Saenger LW DSSR 1 D.U2 E.DA42 U-A WC 20-XX cWW cW-W 2 D.U3 E.DA41 U-A WC 20-XX cWW cW-W 3 D.G4 E.DC40 G-C WC 19-XIX cWW cW-W 4 D.C5 E.DG39 C-G WC 19-XIX cWW cW-W 5 D.G6 E.DC38 G-C WC 19-XIX cWW cW-W 6 D.U7 E.DA37 U-A WC 20-XX cWW cW-W 7 D.U8 E.DA36 U-A WC 20-XX cWW cW-W 8 D.G9 E.DC35 G-C WC 19-XIX cWW cW-W 9 D.A10 E.DT34 A-T WC 20-XX cWW cW-W 10 D.U11 E.DA33 U-A WC 20-XX cWW cW-W 11 D.A12 E.DT32 A-T WC 20-XX cWW cW-W 12 D.A13 E.DT31 A-T WC 20-XX cWW cW-W 13 D.A14 E.DT30 A-T WC 20-XX cWW cW-W 14 D.A15 E.DT29 A-T WC 20-XX cWW cW-W 15 D.G16 E.DC28 G-C WC 19-XIX cWW cW-W 16 D.U17 E.DA27 U-A WC 20-XX cWW cW-W 17 D.A18 E.DT26 A-T WC 20-XX cWW cW-W 18 D.U19 E.DA25 U-A WC 20-XX cWW cW-W 19 D.U20 E.DA24 U-A WC 20-XX cWW cW-W 20 D.G21 D.U67 G-U Wobble 28-XXVIII cWW cW-W 21 D.U22 D.A66 U-A WC 20-XX cWW cW-W 22 D.U23 D.G65 U-G Wobble 28-XXVIII cWW cW-W 23 D.U24 D.A64 U-A WC 20-XX cWW cW-W 24 D.U25 D.A63 U-A WC 20-XX cWW cW-W 25 D.U26 D.A62 U-A WC 20-XX cWW cW-W 26 D.G27 D.C61 G-C WC 19-XIX cWW cW-W 27 D.U28 D.A60 U-A WC 20-XX cWW cW-W 28 D.A29 D.U59 A-U WC 20-XX cWW cW-W 29 D.C30 D.C58 C-C -- -- cWW cW-W 30 D.U31 D.A55 U-A WC 20-XX cWW cW-W 31 D.C32 D.G54 C-G WC 19-XIX cWW cW-W 32 D.U33 D.A53 U-A WC 20-XX cWW cW-W 33 D.A69 D.G81 A-G Sheared 11-XI tHS tM-m 34 D.G70 D.C80 G-C WC 19-XIX cWW cW-W 35 D.G71 D.C79 G-C WC 19-XIX cWW cW-W 36 D.C72 D.G78 C-G WC 19-XIX cWW cW-W 37 D.U73 D.A76 U-A WC 20-XX cWW cW-W 38 D.A87 D.U115 A-U -- -- cW. cW-. 39 D.A88 D.U114 A-U WC 20-XX cWW cW-W 40 D.C89 D.G113 C-G WC 19-XIX cWW cW-W 41 D.A90 D.U112 A-U WC 20-XX cWW cW-W 42 D.C91 D.G111 C-G WC 19-XIX cWW cW-W 43 D.C92 D.G110 C-G WC 19-XIX cWW cW-W 44 E.DT11 G.DA13 T-A WC 20-XX cWW cW-W 45 E.DT12 G.DA12 T-A WC 20-XX cWW cW-W 46 E.DT13 G.DA11 T-A WC 20-XX cWW cW-W 47 E.DC14 G.DG10 C-G WC 19-XIX cWW cW-W 48 E.DA15 G.DT9 A-T WC 20-XX cWW cW-W 49 E.DT16 G.DA8 T-A WC 20-XX cWW cW-W 50 E.DT17 G.DA7 T-A WC 20-XX cWW cW-W 51 E.DT18 G.DA6 T-A WC 20-XX cWW cW-W 52 E.DT19 G.DA5 T-A WC 20-XX cWW cW-W 53 E.DC20 G.DG4 C-G WC 19-XIX cWW cW-W 54 E.DT21 G.DA3 T-A WC 20-XX cWW cW-W 55 E.DG22 G.DC2 G-C WC 19-XIX cWW cW-W 56 E.DC23 G.DG1 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 4 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[3] bps=32 strand-1 5'-UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU-3' bp-type ||||||||||||||||||||||||||||.||| strand-2 3'-AACGCAACTATTTTCATAAUAGAAACAUCAGA-5' helix-form AAA..A.AAAA..A....x...AAAAA.xAA 1 D.U2 E.DA42 U-A WC 20-XX cWW cW-W 2 D.U3 E.DA41 U-A WC 20-XX cWW cW-W 3 D.G4 E.DC40 G-C WC 19-XIX cWW cW-W 4 D.C5 E.DG39 C-G WC 19-XIX cWW cW-W 5 D.G6 E.DC38 G-C WC 19-XIX cWW cW-W 6 D.U7 E.DA37 U-A WC 20-XX cWW cW-W 7 D.U8 E.DA36 U-A WC 20-XX cWW cW-W 8 D.G9 E.DC35 G-C WC 19-XIX cWW cW-W 9 D.A10 E.DT34 A-T WC 20-XX cWW cW-W 10 D.U11 E.DA33 U-A WC 20-XX cWW cW-W 11 D.A12 E.DT32 A-T WC 20-XX cWW cW-W 12 D.A13 E.DT31 A-T WC 20-XX cWW cW-W 13 D.A14 E.DT30 A-T WC 20-XX cWW cW-W 14 D.A15 E.DT29 A-T WC 20-XX cWW cW-W 15 D.G16 E.DC28 G-C WC 19-XIX cWW cW-W 16 D.U17 E.DA27 U-A WC 20-XX cWW cW-W 17 D.A18 E.DT26 A-T WC 20-XX cWW cW-W 18 D.U19 E.DA25 U-A WC 20-XX cWW cW-W 19 D.U20 E.DA24 U-A WC 20-XX cWW cW-W 20 D.G21 D.U67 G-U Wobble 28-XXVIII cWW cW-W 21 D.U22 D.A66 U-A WC 20-XX cWW cW-W 22 D.U23 D.G65 U-G Wobble 28-XXVIII cWW cW-W 23 D.U24 D.A64 U-A WC 20-XX cWW cW-W 24 D.U25 D.A63 U-A WC 20-XX cWW cW-W 25 D.U26 D.A62 U-A WC 20-XX cWW cW-W 26 D.G27 D.C61 G-C WC 19-XIX cWW cW-W 27 D.U28 D.A60 U-A WC 20-XX cWW cW-W 28 D.A29 D.U59 A-U WC 20-XX cWW cW-W 29 D.C30 D.C58 C-C -- -- cWW cW-W 30 D.U31 D.A55 U-A WC 20-XX cWW cW-W 31 D.C32 D.G54 C-G WC 19-XIX cWW cW-W 32 D.U33 D.A53 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=5 strand-1 5'-AGGCU-3' bp-type .|||| strand-2 3'-GCCGA-5' helix-form .AAx 1 D.A69 D.G81 A-G Sheared 11-XI tHS tM-m 2 D.G70 D.C80 G-C WC 19-XIX cWW cW-W 3 D.G71 D.C79 G-C WC 19-XIX cWW cW-W 4 D.C72 D.G78 C-G WC 19-XIX cWW cW-W 5 D.U73 D.A76 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#3[1] bps=6 strand-1 5'-AACACC-3' bp-type .||||| strand-2 3'-UUGUGG-5' helix-form ..... 1 D.A87 D.U115 A-U -- -- cW. cW-. 2 D.A88 D.U114 A-U WC 20-XX cWW cW-W 3 D.C89 D.G113 C-G WC 19-XIX cWW cW-W 4 D.A90 D.U112 A-U WC 20-XX cWW cW-W 5 D.C91 D.G111 C-G WC 19-XIX cWW cW-W 6 D.C92 D.G110 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#4[1] bps=13 strand-1 5'-TTTCATTTTCTGC-3' bp-type ||||||||||||| strand-2 3'-AAAGTAAAAGACG-5' helix-form .BBBB.BB.BBB 1 E.DT11 G.DA13 T-A WC 20-XX cWW cW-W 2 E.DT12 G.DA12 T-A WC 20-XX cWW cW-W 3 E.DT13 G.DA11 T-A WC 20-XX cWW cW-W 4 E.DC14 G.DG10 C-G WC 19-XIX cWW cW-W 5 E.DA15 G.DT9 A-T WC 20-XX cWW cW-W 6 E.DT16 G.DA8 T-A WC 20-XX cWW cW-W 7 E.DT17 G.DA7 T-A WC 20-XX cWW cW-W 8 E.DT18 G.DA6 T-A WC 20-XX cWW cW-W 9 E.DT19 G.DA5 T-A WC 20-XX cWW cW-W 10 E.DC20 G.DG4 C-G WC 19-XIX cWW cW-W 11 E.DT21 G.DA3 T-A WC 20-XX cWW cW-W 12 E.DG22 G.DC2 G-C WC 19-XIX cWW cW-W 13 E.DC23 G.DG1 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 6 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=19 strand-1 5'-UUGCGUUGAUAAAAGUAUU-3' bp-type ||||||||||||||||||| strand-2 3'-AACGCAACTATTTTCATAA-5' helix-form AAA..A.AAAA..A.... 1 D.U2 E.DA42 U-A WC 20-XX cWW cW-W 2 D.U3 E.DA41 U-A WC 20-XX cWW cW-W 3 D.G4 E.DC40 G-C WC 19-XIX cWW cW-W 4 D.C5 E.DG39 C-G WC 19-XIX cWW cW-W 5 D.G6 E.DC38 G-C WC 19-XIX cWW cW-W 6 D.U7 E.DA37 U-A WC 20-XX cWW cW-W 7 D.U8 E.DA36 U-A WC 20-XX cWW cW-W 8 D.G9 E.DC35 G-C WC 19-XIX cWW cW-W 9 D.A10 E.DT34 A-T WC 20-XX cWW cW-W 10 D.U11 E.DA33 U-A WC 20-XX cWW cW-W 11 D.A12 E.DT32 A-T WC 20-XX cWW cW-W 12 D.A13 E.DT31 A-T WC 20-XX cWW cW-W 13 D.A14 E.DT30 A-T WC 20-XX cWW cW-W 14 D.A15 E.DT29 A-T WC 20-XX cWW cW-W 15 D.G16 E.DC28 G-C WC 19-XIX cWW cW-W 16 D.U17 E.DA27 U-A WC 20-XX cWW cW-W 17 D.A18 E.DT26 A-T WC 20-XX cWW cW-W 18 D.U19 E.DA25 U-A WC 20-XX cWW cW-W 19 D.U20 E.DA24 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=9 strand-1 5'-GUUUUUGUA-3' bp-type ||||||||| strand-2 3'-UAGAAACAU-5' helix-form ...AAAAA 1 D.G21 D.U67 G-U Wobble 28-XXVIII cWW cW-W 2 D.U22 D.A66 U-A WC 20-XX cWW cW-W 3 D.U23 D.G65 U-G Wobble 28-XXVIII cWW cW-W 4 D.U24 D.A64 U-A WC 20-XX cWW cW-W 5 D.U25 D.A63 U-A WC 20-XX cWW cW-W 6 D.U26 D.A62 U-A WC 20-XX cWW cW-W 7 D.G27 D.C61 G-C WC 19-XIX cWW cW-W 8 D.U28 D.A60 U-A WC 20-XX cWW cW-W 9 D.A29 D.U59 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#1] bps=3 strand-1 5'-UCU-3' bp-type ||| strand-2 3'-AGA-5' helix-form AA 1 D.U31 D.A55 U-A WC 20-XX cWW cW-W 2 D.C32 D.G54 C-G WC 19-XIX cWW cW-W 3 D.U33 D.A53 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#4[#2] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-CCG-5' helix-form AA 1 D.G70 D.C80 G-C WC 19-XIX cWW cW-W 2 D.G71 D.C79 G-C WC 19-XIX cWW cW-W 3 D.C72 D.G78 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#3] bps=5 strand-1 5'-ACACC-3' bp-type ||||| strand-2 3'-UGUGG-5' helix-form .... 1 D.A88 D.U114 A-U WC 20-XX cWW cW-W 2 D.C89 D.G113 C-G WC 19-XIX cWW cW-W 3 D.A90 D.U112 A-U WC 20-XX cWW cW-W 4 D.C91 D.G111 C-G WC 19-XIX cWW cW-W 5 D.C92 D.G110 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#4] bps=13 strand-1 5'-TTTCATTTTCTGC-3' bp-type ||||||||||||| strand-2 3'-AAAGTAAAAGACG-5' helix-form .BBBB.BB.BBB 1 E.DT11 G.DA13 T-A WC 20-XX cWW cW-W 2 E.DT12 G.DA12 T-A WC 20-XX cWW cW-W 3 E.DT13 G.DA11 T-A WC 20-XX cWW cW-W 4 E.DC14 G.DG10 C-G WC 19-XIX cWW cW-W 5 E.DA15 G.DT9 A-T WC 20-XX cWW cW-W 6 E.DT16 G.DA8 T-A WC 20-XX cWW cW-W 7 E.DT17 G.DA7 T-A WC 20-XX cWW cW-W 8 E.DT18 G.DA6 T-A WC 20-XX cWW cW-W 9 E.DT19 G.DA5 T-A WC 20-XX cWW cW-W 10 E.DC20 G.DG4 C-G WC 19-XIX cWW cW-W 11 E.DT21 G.DA3 T-A WC 20-XX cWW cW-W 12 E.DG22 G.DC2 G-C WC 19-XIX cWW cW-W 13 E.DC23 G.DG1 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 1 isolated WC/wobble pair Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#2] -1 D.U73 D.A76 U-A WC 20-XX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#1 contains 3 stems: [#1,#2,#3] **************************************************************************** List of 12 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 RU C.ARG223,D.U77 2 nts=2 HU C.HIS1108,D.U115 3 nts=2 GA D.G21,E.DA24 4 nts=2 AC D.A29,D.C30 5 nts=2 CU D.C58,D.U59 6 nts=2 CU D.C72,D.U73 7 nts=2 AA D.A87,D.A88 8 nts=3 RGG C.ARG53,D.G81,D.G70 9 nts=3 AAG D.A55,D.A56,D.G57 10 nts=3 CAG D.C75,D.A76,D.G78 11 nts=4 RAAU C.ARG46,D.A83,D.A84,D.U85 12 nts=4 NAAA C.ASN49,D.A82,D.A68,D.A69 **************************************************************************** Nucleotides not involved in stacking interactions nts=5 UUUCC D.U2,D.U20,D.U31,D.C86,D.C92 **************************************************************************** List of 1 atom-base capping interaction dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@D.C75 D.A76 3.24 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 hairpin loop 1 hairpin loop: nts=4; [2]; linked by [#-1] summary: [1] 2 [D.73 D.76] 1 nts=4 UUCA D.U73,D.U74,D.C75,D.A76 nts=2 UC D.U74,D.C75 **************************************************************************** List of 1 bulge 1 bulge: nts=5; [0,1]; linked by [#4,#-1] summary: [2] 0 1 [D.72 D.78 D.73 D.76] 3 1 nts=5 CUAUG D.C72,D.U73,D.A76,D.U77,D.G78 nts=0 nts=1 U D.U77 **************************************************************************** List of 1 internal loop 1 asymmetric internal loop: nts=8; [1,3]; linked by [#2,#3] summary: [2] 1 3 [D.29 D.59 D.31 D.55] 9 3 nts=8 ACUAAGCU D.A29,D.C30,D.U31,D.A55,D.A56,D.G57,D.C58,D.U59 nts=1 C D.C30 nts=3 AGC D.A56,D.G57,D.C58 **************************************************************************** List of 3 non-loop single-stranded segments 1 nts=2 AA D.A68,D.A69 2 nts=7 GAAAUCA D.G81,D.A82,D.A83,D.A84,D.U85,D.C86,D.A87 3 nts=1 U D.U115 **************************************************************************** List of 6 splayed-apart dinucleotides 1 D.U67 D.A68 angle=154 distance=18.0 ratio=0.98 2 D.A76 D.U77 angle=132 distance=17.6 ratio=0.91 3 D.U77 D.G78 angle=127 distance=18.1 ratio=0.90 4 D.A82 D.A83 angle=127 distance=17.1 ratio=0.90 5 D.C86 D.A87 angle=111 distance=16.9 ratio=0.82 6 E.DC23 E.DA24 angle=145 distance=20.1 ratio=0.95 ---------------------------------------------------------------- Summary of 5 splayed-apart units 1 nts=2 UA D.U67,D.A68 2 nts=3 AUG D.A76,D.U77,D.G78 3 nts=2 AA D.A82,D.A83 4 nts=2 CA D.C86,D.A87 5 nts=2 CA E.DC23,E.DA24 **************************************************************************** Special notes: o cross-paired segments in separate chains, be *careful* with .dbn **************************************************************************** This structure contains *1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. o The DSSR-derived dbn may be problematic (see notes above). **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6rjg nts=123 [whole] UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU&AGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACC&GGUGUU&TTTCATTTTCTGCAATACTTTTATCAACGCAA&GCAGAAAATGAAA ((((((((((((((((((((((((((((.(((&)))...)))))))))..((((..).))).......(((((&))))).&[[[[[[[[[[[[[)))))))))))))))))))&]]]]]]]]]]]]] >6rjg-D #1 nts=78 0.38(3.19) [chain] RNA* UUGCGUUGAUAAAAGUAUUGUUUUUGUACUCU&AGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACC&GGUGUU ((((((((((((((((((((((((((((.(((&)))...)))))))))..((((..).))).......(((((&))))). >6rjg-E #2 nts=32 2.97(1.05) [chain] DNA TTTCATTTTCTGCAATACTTTTATCAACGCAA [[[[[[[[[[[[[))))))))))))))))))) >6rjg-G #3 nts=13 3.39(0.39) [chain] DNA GCAGAAAATGAAA ]]]]]]]]]]]]] **************************************************************************** Summary of structural features of 123 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 U ( D.U2 0.013 anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end,coaxial-stack 2 U ( D.U3 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 3 G ( D.G4 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 4 C ( D.C5 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 5 G ( D.G6 0.018 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 6 U ( D.U7 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 U ( D.U8 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 8 G ( D.G9 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 9 A ( D.A10 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 10 U ( D.U11 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 11 A ( D.A12 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 12 A ( D.A13 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 13 A ( D.A14 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 14 A ( D.A15 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 15 G ( D.G16 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 16 U ( D.U17 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 17 A ( D.A18 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 18 U ( D.U19 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 19 U ( D.U20 0.022 anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,coaxial-stack,phosphate 20 G ( D.G21 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 21 U ( D.U22 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 22 U ( D.U23 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 23 U ( D.U24 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 24 U ( D.U25 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 25 U ( D.U26 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 26 G ( D.G27 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 U ( D.U28 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 28 A ( D.A29 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 29 C . D.C30 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 30 U ( D.U31 0.011 anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,coaxial-stack,internal-loop,phosphate 31 C ( D.C32 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 32 U ( D.U33 0.011 break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 33 A ) D.A53 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 34 G ) D.G54 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 35 A ) D.A55 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 36 A . D.A56 0.009 anti,~C3'-endo,BI,non-pair-contact,internal-loop 37 G . D.G57 0.007 turn,anti,~C2'-endo,non-pair-contact,internal-loop 38 C . D.C58 0.020 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 39 U ) D.U59 0.020 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 40 A ) D.A60 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 41 C ) D.C61 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 A ) D.A62 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 43 A ) D.A63 0.021 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 44 A ) D.A64 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 45 G ) D.G65 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 46 A ) D.A66 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 47 U ) D.U67 0.011 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart 48 A . D.A68 0.023 syn,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 49 A . D.A69 0.018 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 50 G ( D.G70 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 51 G ( D.G71 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 52 C ( D.C72 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge,phosphate 53 U ( D.U73 0.018 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,phosphate 54 U . D.U74 0.014 anti,~C2'-endo,BI,non-pair-contact,hairpin-loop 55 C . D.C75 0.013 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 56 A ) D.A76 0.016 ~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,cap-acceptor,splayed-apart 57 U . D.U77 0.014 turn,anti,~C3'-endo,bulge,splayed-apart 58 G ) D.G78 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge,phosphate,splayed-apart 59 C ) D.C79 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 60 C ) D.C80 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 61 G . D.G81 0.020 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 62 A . D.A82 0.019 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 63 A . D.A83 0.010 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 64 A . D.A84 0.010 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 65 U . D.U85 0.007 anti,~C3'-endo,non-pair-contact,ss-non-loop 66 C . D.C86 0.012 anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 67 A . D.A87 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart 68 A ( D.A88 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 69 C ( D.C89 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 70 A ( D.A90 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 71 C ( D.C91 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 72 C ( D.C92 0.020 break,anti,~C3'-endo,non-stack,canonical,helix-end,stem-end 73 G ) D.G110 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 74 G ) D.G111 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 75 U ) D.U112 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 76 G ) D.G113 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 77 U ) D.U114 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end 78 U . D.U115 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 79 T [ E.DT11 0.007 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 80 T [ E.DT12 0.007 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 81 T [ E.DT13 0.006 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem 82 C [ E.DC14 0.008 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 83 A [ E.DA15 0.011 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 84 T [ E.DT16 0.019 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 85 T [ E.DT17 0.012 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 86 T [ E.DT18 0.016 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 87 T [ E.DT19 0.012 pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 88 C [ E.DC20 0.008 pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 89 T [ E.DT21 0.010 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 90 G [ E.DG22 0.011 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem 91 C [ E.DC23 0.007 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,splayed-apart 92 A ) E.DA24 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart 93 A ) E.DA25 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 94 T ) E.DT26 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 95 A ) E.DA27 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 96 C ) E.DC28 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 97 T ) E.DT29 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 98 T ) E.DT30 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 99 T ) E.DT31 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 100 T ) E.DT32 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 101 A ) E.DA33 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 102 T ) E.DT34 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 103 C ) E.DC35 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 104 A ) E.DA36 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 105 A ) E.DA37 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 106 C ) E.DC38 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 107 G ) E.DG39 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 108 C ) E.DC40 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 109 A ) E.DA41 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 110 A ) E.DA42 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 111 G ] G.DG1 0.012 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 112 C ] G.DC2 0.009 pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 113 A ] G.DA3 0.017 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 114 G ] G.DG4 0.012 pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 115 A ] G.DA5 0.009 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 116 A ] G.DA6 0.011 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 117 A ] G.DA7 0.010 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 118 A ] G.DA8 0.010 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 119 T ] G.DT9 0.008 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 120 G ] G.DG10 0.016 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem 121 A ] G.DA11 0.007 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 122 A ] G.DA12 0.008 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 123 A ] G.DA13 0.008 pseudoknotted,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 17 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-bulges.pdb -- an ensemble of bulges 6 dssr-iloops.pdb -- an ensemble of internal loops 7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 8 dssr-2ndstrs.ct -- secondary structure in connectivity table format 9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 10 dssr-torsions.txt -- backbone torsion angles and suite names 11 dssr-splays.pdb -- an ensemble of splayed-apart units 12 dssr-stacks.pdb -- an ensemble of base stacks 13 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 14 dssr-rotmat.txt -- position vector and rotation matrix 15 dssr-viewV.pdb -- vertical view of the principal moment of inertia 16 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 17 dssr-viewT.pdb -- top view of the principal moment of inertia